RNA id: TU806781



Basic Information


Item Value
RNA id TU806781
length 323
RNA type TUCP
GC content 0.56
exon number 1
gene id G709454
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43170760 ~ 43171082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ttgttggtaatcaagcctaccactgttgtgtcgtccgcaaacttgatgattgagttggaggcgtgcgtggccacgcagtcgtgggtgaacagggagtacaggagagggctcagaacgcacccttgtgggggccccagtgttgaggatcagcggggtggaaatgttgttgcctaccctcaccacctggggatggcccgtcaggaagtccagtacccagttgcacagggcggggtcgagacccagggtctcgagcttgatgacgagcttggagggtactatggtgttaaatgctgagctgtagtcgatgaacagcattctcacat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU806751 lncRNA downstream 35427 43135034 ~ 43135333 (-) True G709426
TU806700 lncRNA downstream 68352 43102205 ~ 43102408 (-) True G709375
TU806682 lncRNA downstream 79109 43091418 ~ 43091651 (-) True G709358
TU806679 lncRNA downstream 82264 43088204 ~ 43088496 (-) True G709355
TU806671 lncRNA downstream 87363 43083116 ~ 43083397 (-) True G709347
TU806809 lncRNA upstream 19511 43190593 ~ 43190854 (-) True G709482
TU806810 lncRNA upstream 20227 43191309 ~ 43191600 (-) True G709483
TU806846 lncRNA upstream 42444 43213526 ~ 43213917 (-) True G709519
TU806930 lncRNA upstream 99572 43270654 ~ 43270857 (-) True G709597
TU806936 lncRNA upstream 105240 43276322 ~ 43276523 (-) True G709603
XM_021612583.2 mRNA downstream 644174 42431791 ~ 42526586 (-) True puf60a
XM_021612585.2 mRNA downstream 644233 42431791 ~ 42526527 (-) False puf60a
XM_021612584.2 mRNA downstream 645091 42431791 ~ 42525669 (-) False puf60a
XM_036985478.1 mRNA downstream 750673 42340682 ~ 42420087 (-) False klhl18
XM_021612591.2 mRNA upstream 428672 43599754 ~ 43602305 (-) False mycb
XM_021612593.2 mRNA upstream 428672 43599754 ~ 43602305 (-) True mycb
XR_005053023.1 mRNA upstream 588247 43759329 ~ 43763318 (-) True LOC118965613
XM_021612600.2 mRNA upstream 1013911 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA upstream 1013911 44184993 ~ 44436559 (-) False efr3a
TU806574 other downstream 450061 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 3211147 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 3944447 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 4856957 38313489 ~ 38313803 (-) True G704874
TU801610 other downstream 5132414 38037725 ~ 38038346 (-) True G704702
TU808567 other upstream 1367711 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 2286695 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 3140048 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 3880385 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 4007342 47178424 ~ 47178736 (-) True G714425

Expression Profile


TU806781 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU806781 Expression in each Bioproject

Bar chart with 20 bars.
TU806781 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.