RNA id: TU806846



Basic Information


Item Value
RNA id TU806846
length 392
lncRNA type inter_gene
GC content 0.44
exon number 1
gene id G709519
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43213526 ~ 43213917 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttttgcattgttgccaaaaagttacattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgacacttttcatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctcctt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU806810 lncRNA downstream 21926 43191309 ~ 43191600 (-) True G709483
TU806809 lncRNA downstream 22672 43190593 ~ 43190854 (-) True G709482
TU806751 lncRNA downstream 78193 43135034 ~ 43135333 (-) True G709426
TU806700 lncRNA downstream 111118 43102205 ~ 43102408 (-) True G709375
TU806682 lncRNA downstream 121875 43091418 ~ 43091651 (-) True G709358
TU806930 lncRNA upstream 56737 43270654 ~ 43270857 (-) True G709597
TU806936 lncRNA upstream 62405 43276322 ~ 43276523 (-) True G709603
TU806942 lncRNA upstream 65574 43279491 ~ 43279707 (-) True G709609
TU806977 lncRNA upstream 76914 43290831 ~ 43355044 (-) False G709639
TU806980 lncRNA upstream 76914 43290831 ~ 43357266 (-) False G709639
XM_021612583.2 mRNA downstream 686940 42431791 ~ 42526586 (-) True puf60a
XM_021612585.2 mRNA downstream 686999 42431791 ~ 42526527 (-) False puf60a
XM_021612584.2 mRNA downstream 687857 42431791 ~ 42525669 (-) False puf60a
XM_036985478.1 mRNA downstream 793439 42340682 ~ 42420087 (-) False klhl18
XM_021612591.2 mRNA upstream 385837 43599754 ~ 43602305 (-) False mycb
XM_021612593.2 mRNA upstream 385837 43599754 ~ 43602305 (-) True mycb
XR_005053023.1 mRNA upstream 545412 43759329 ~ 43763318 (-) True LOC118965613
XM_021612600.2 mRNA upstream 971076 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA upstream 971076 44184993 ~ 44436559 (-) False efr3a
TU806781 other downstream 42444 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 492827 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 3253913 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 3987213 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 4899723 38313489 ~ 38313803 (-) True G704874
TU808567 other upstream 1324876 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 2243860 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 3097213 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 3837550 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 3964507 47178424 ~ 47178736 (-) True G714425

Expression Profile


TU806846 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU806846 Expression in each Bioproject

Bar chart with 20 bars.
TU806846 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.