RNA id: TU807033



Basic Information


Item Value
RNA id TU807033
length 271
lncRNA type inter_gene
GC content 0.34
exon number 2
gene id G709667
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43380559 ~ 43381176 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


catttcagatcaccagttgcacatttcagatcaccagttgcacggaggaaaatcgttacttttgactttgacttttgacttcctatgacatcatattgcaaatggagaaaacatatgccttatgcacaagtaaaacaaaaataaatatgataatacaagttgacaaaggtatagtttgagcaaagtaaagtttgaattttgagcatgacaaattcgtgatggtacctgcccattaaaacatattgcaaatgcacagtgactttgaaaaagt

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU807029 lncRNA downstream 2895 43374947 ~ 43377664 (-) True G709663
TU806988 lncRNA downstream 3467 43364929 ~ 43377092 (-) False G709639
TU806978 lncRNA downstream 3467 43366804 ~ 43377092 (-) True G709639
TU806985 lncRNA downstream 6911 43297059 ~ 43373648 (-) False G709639
TU807028 lncRNA downstream 7717 43369730 ~ 43372842 (-) True G709662
TU807209 lncRNA upstream 139249 43520425 ~ 43520797 (-) True G709835
TU807894 lncRNA upstream 206508 43587684 ~ 43588262 (-) True G710488
TU807896 lncRNA upstream 208479 43589655 ~ 43589884 (-) True G710490
TU808198 lncRNA upstream 662470 44043646 ~ 44043959 (-) True G710781
TU808202 lncRNA upstream 671854 44053030 ~ 44056352 (-) True G710785
XM_021612583.2 mRNA downstream 853973 42431791 ~ 42526586 (-) True puf60a
XM_021612585.2 mRNA downstream 854032 42431791 ~ 42526527 (-) False puf60a
XM_021612584.2 mRNA downstream 854890 42431791 ~ 42525669 (-) False puf60a
XM_036985478.1 mRNA downstream 960472 42340682 ~ 42420087 (-) False klhl18
XM_021612591.2 mRNA upstream 218578 43599754 ~ 43602305 (-) False mycb
XM_021612593.2 mRNA upstream 218578 43599754 ~ 43602305 (-) True mycb
XR_005053023.1 mRNA upstream 378153 43759329 ~ 43763318 (-) True LOC118965613
XM_021612600.2 mRNA upstream 803817 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA upstream 803817 44184993 ~ 44436559 (-) False efr3a
TU806781 other downstream 209477 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 659860 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 3420946 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 4154246 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 5066756 38313489 ~ 38313803 (-) True G704874
TU808567 other upstream 1157617 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 2076601 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 2929954 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 3670291 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 3797248 47178424 ~ 47178736 (-) True G714425

Expression Profile


TU807033 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU807033 Expression in each Bioproject

Bar chart with 16 bars.
TU807033 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.