RNA id: TU807209



Basic Information


Item Value
RNA id TU807209
length 373
lncRNA type inter_gene
GC content 0.52
exon number 1
gene id G709835
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43520425 ~ 43520797 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctggtatagggattgattgaatatgtccgtaaacacaccggccagctggtctgcgcatgctctgagggcgcggctgggtatgccatctgggcctgcagccttgcgagggttaacacgtttaaatgtcttactcacctcggctgcagtgaaggagagaccgcatgttttcgttgcaggccgtgtcagtggcactgtattgtcctcaaagcgggcaaaaaagttatttagtctgcctgggagcaagacatcctggtccgtgactgggctggatttcttcctgtagtccgtgattgactgtagaccctgccacatgcctcttgtgtctgagccgttgaattgagattctactttgtctctgtactgacgcttagct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU807033 lncRNA downstream 139249 43380559 ~ 43381176 (-) True G709667
TU807029 lncRNA downstream 142761 43374947 ~ 43377664 (-) True G709663
TU806988 lncRNA downstream 143333 43364929 ~ 43377092 (-) False G709639
TU807894 lncRNA upstream 66887 43587684 ~ 43588262 (-) True G710488
TU807896 lncRNA upstream 68858 43589655 ~ 43589884 (-) True G710490
TU808198 lncRNA upstream 522849 44043646 ~ 44043959 (-) True G710781
TU808202 lncRNA upstream 532233 44053030 ~ 44056352 (-) True G710785
TU808219 lncRNA upstream 547142 44067939 ~ 44068194 (-) True G710800
XM_021612583.2 mRNA downstream 993839 42431791 ~ 42526586 (-) True puf60a
XM_021612585.2 mRNA downstream 993898 42431791 ~ 42526527 (-) False puf60a
XM_021612584.2 mRNA downstream 994756 42431791 ~ 42525669 (-) False puf60a
XM_036985478.1 mRNA downstream 1100338 42340682 ~ 42420087 (-) False klhl18
XM_021612591.2 mRNA upstream 78957 43599754 ~ 43602305 (-) False mycb
XM_021612593.2 mRNA upstream 78957 43599754 ~ 43602305 (-) True mycb
XR_005053023.1 mRNA upstream 238532 43759329 ~ 43763318 (-) True LOC118965613
XM_021612600.2 mRNA upstream 664196 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA upstream 664196 44184993 ~ 44436559 (-) False efr3a
TU806781 other downstream 349343 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 799726 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 3560812 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 4294112 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 5206622 38313489 ~ 38313803 (-) True G704874
TU808567 other upstream 1017996 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 1936980 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 2790333 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 3530670 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 3657627 47178424 ~ 47178736 (-) True G714425

Expression Profile


TU807209 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU807209 Expression in each Bioproject

Bar chart with 18 bars.
TU807209 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.