RNA id: TU808437



Basic Information


Item Value
RNA id TU808437
length 465
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G711007
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44437905 ~ 44438369 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cacgctgaagtcaaagtatgatgctgtgggcgccgcacagtttccacggttcatccctgacacaatgcctcagctccgcacccaagctgctcagatgctctccatgttcggcagcacttatctatgcgagcaacttttctcctcgatgaagatgaccaaaacaactcacaggagacgtctgactgatgaacatcttcgctcgatactaaggatttcttcagctcacagcttgagcccagacattgatgaactagcatccaagaagagatgccaggtatctggcttgggcacatcagattagaccagtgtgcaataattaacgttttctttatgcactttttcttgctacaaggcatgggcttgaatggttgattgatttattatcattttatttgtaaaatgattagccagtggaaaaagtttattttggtatttaaatcagaaggctgcaaatagaaaagaggc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU808241 lncRNA downstream 341947 44094015 ~ 44095958 (-) True G710822
TU808239 lncRNA downstream 349216 44088363 ~ 44088689 (-) True G710820
TU808238 lncRNA downstream 350044 44087661 ~ 44087861 (-) True G710819
TU808236 lncRNA downstream 351495 44086173 ~ 44086410 (-) True G710817
TU808228 lncRNA downstream 362669 44074758 ~ 44075236 (-) True G710809
TU808540 lncRNA upstream 83625 44521994 ~ 44522225 (-) True G711107
TU808555 lncRNA upstream 93596 44531965 ~ 44532192 (-) True G711121
TU808565 lncRNA upstream 99456 44537825 ~ 44538121 (-) True G711131
TU809677 lncRNA upstream 111900 44550269 ~ 44629270 (-) True G712181
TU809690 lncRNA upstream 126073 44564442 ~ 44609392 (-) True G712194
XM_021612600.2 mRNA downstream 1346 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA downstream 1346 44184993 ~ 44436559 (-) False efr3a
XM_021612602.2 mRNA downstream 1346 44184993 ~ 44436559 (-) True efr3a
XR_002474453.2 mRNA downstream 43266 44390878 ~ 44394639 (-) True LOC110529930
XR_005053023.1 mRNA downstream 674587 43759329 ~ 43763318 (-) True LOC118965613
XR_002474328.2 mRNA upstream 542600 44980969 ~ 44984268 (-) True LOC110529115
XM_021612606.2 mRNA upstream 683714 45122083 ~ 45173741 (-) True basp1
XM_021612608.2 mRNA upstream 1046649 45485018 ~ 45495100 (-) False znf622
XM_021612609.2 mRNA upstream 1046649 45485018 ~ 45495101 (-) False znf622
XM_036985484.1 mRNA upstream 1046649 45485018 ~ 45495101 (-) True znf622
TU806781 other downstream 1266823 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 1717206 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 4478292 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 5211592 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 6124102 38313489 ~ 38313803 (-) True G704874
TU808567 other upstream 100424 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 1019408 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 1872761 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 2613098 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 2740055 47178424 ~ 47178736 (-) True G714425

Expression Profile


TU808437 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU808437 Expression in each Bioproject

Bar chart with 19 bars.
TU808437 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.