RNA id: TU809709



Basic Information


Item Value
RNA id TU809709
length 225
lncRNA type inter_gene
GC content 0.41
exon number 2
gene id G712210
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44585333 ~ 44589776 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttatgtgaactaggtccgtgcacgtaaaactgcgggacaagatatctctgactcattaaaactgtcttttgttacaactgaaatccactctgtccagcgtccgtgatttggtctcaactctccagtttttgaacactaacagaattggtagcagagtttggttgttcttgaattcgatctattataagttagtgtgagaggacgagactgatcacggctaaaaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU808565 lncRNA downstream 47212 44537825 ~ 44538121 (-) True G711131
TU808555 lncRNA downstream 53141 44531965 ~ 44532192 (-) True G711121
TU808540 lncRNA downstream 63108 44521994 ~ 44522225 (-) True G711107
TU808437 lncRNA downstream 146964 44437905 ~ 44438369 (-) True G711007
TU808241 lncRNA downstream 489375 44094015 ~ 44095958 (-) True G710822
TU809935 lncRNA upstream 389197 44978973 ~ 44979408 (-) True G712421
TU810142 lncRNA upstream 634443 45224219 ~ 45224544 (-) True G712622
TU810311 lncRNA upstream 831395 45421171 ~ 45421678 (-) True G712787
TU810312 lncRNA upstream 832173 45421949 ~ 45422344 (-) True G712788
TU810313 lncRNA upstream 834604 45424380 ~ 45424611 (-) True G712789
XM_021612600.2 mRNA downstream 148774 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA downstream 148774 44184993 ~ 44436559 (-) False efr3a
XM_021612602.2 mRNA downstream 148774 44184993 ~ 44436559 (-) True efr3a
XR_002474453.2 mRNA downstream 190694 44390878 ~ 44394639 (-) True LOC110529930
XR_005053023.1 mRNA downstream 822015 43759329 ~ 43763318 (-) True LOC118965613
XR_002474328.2 mRNA upstream 391193 44980969 ~ 44984268 (-) True LOC110529115
XM_021612606.2 mRNA upstream 532307 45122083 ~ 45173741 (-) True basp1
XM_021612608.2 mRNA upstream 895242 45485018 ~ 45495100 (-) False znf622
XM_021612609.2 mRNA upstream 895242 45485018 ~ 45495101 (-) False znf622
XM_036985484.1 mRNA upstream 895242 45485018 ~ 45495101 (-) True znf622
TU808567 other downstream 45829 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 1414251 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 1864634 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 4625720 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 5359020 39219644 ~ 39226313 (-) True G706683
TU810338 other upstream 868001 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 1721354 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 2461691 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 2588648 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 3699166 48288942 ~ 48289581 (-) True G715865

Expression Profile


TU809709 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU809709 Expression in each Bioproject

Bar chart with 13 bars.
TU809709 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.