RNA id: TU810142



Basic Information


Item Value
RNA id TU810142
length 304
lncRNA type intronic
GC content 0.48
exon number 2
gene id G712622
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45224219 ~ 45224544 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gggggcaaactacctgccctccaggacacctacaccaaccgatgtcacaggaaggccataaagatcatcaaggacatcaaccacccgagccactgcctgttcaccccgctatcatccagaaggcgaggtcagtacaggtgcatcaaagctgggaccgagagactgaaaaacagcttctatctcaaggccatcagactgttaaacagccaccactaacactgacactgactcaactccagccactttaataatgggaattgatgggaaatgatgtaaatatatcactagccactttaaacaatgc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU809935 lncRNA downstream 244811 44978973 ~ 44979408 (-) True G712421
TU809677 lncRNA downstream 594949 44550269 ~ 44629270 (-) True G712181
TU809690 lncRNA downstream 614827 44564442 ~ 44609392 (-) True G712194
TU809713 lncRNA downstream 630224 44589551 ~ 44593995 (-) True G712213
TU809711 lncRNA downstream 630825 44588373 ~ 44593394 (-) False G712212
TU810311 lncRNA upstream 196627 45421171 ~ 45421678 (-) True G712787
TU810312 lncRNA upstream 197405 45421949 ~ 45422344 (-) True G712788
TU810313 lncRNA upstream 199836 45424380 ~ 45424611 (-) True G712789
TU810318 lncRNA upstream 206229 45430773 ~ 45430996 (-) True G712794
TU810327 lncRNA upstream 220665 45445209 ~ 45445543 (-) True G712803
XM_021612606.2 mRNA downstream 50478 45122083 ~ 45173741 (-) True basp1
XR_002474328.2 mRNA downstream 239951 44980969 ~ 44984268 (-) True LOC110529115
XM_021612600.2 mRNA downstream 787660 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA downstream 787660 44184993 ~ 44436559 (-) False efr3a
XM_021612602.2 mRNA downstream 787660 44184993 ~ 44436559 (-) True efr3a
XM_021612608.2 mRNA upstream 260474 45485018 ~ 45495100 (-) False znf622
XM_021612609.2 mRNA upstream 260474 45485018 ~ 45495101 (-) False znf622
XM_036985484.1 mRNA upstream 260474 45485018 ~ 45495101 (-) True znf622
XM_021612611.2 mRNA upstream 284537 45509081 ~ 45546117 (-) False retreg1
XM_021612610.2 mRNA upstream 284537 45509081 ~ 45601564 (-) True retreg1
TU808567 other downstream 684715 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 2053137 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 2503520 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 5264606 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 5997906 39219644 ~ 39226313 (-) True G706683
TU810338 other upstream 233233 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 1086586 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 1826923 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 1953880 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 3064398 48288942 ~ 48289581 (-) True G715865

Expression Profile


TU810142 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU810142 Expression in each Bioproject

Bar chart with 17 bars.
TU810142 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.