RNA id: TU810506



Basic Information


Item Value
RNA id TU810506
length 212
lncRNA type inter_gene
GC content 0.36
exon number 1
gene id G712972
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45717665 ~ 45717876 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ACAGAACTATTGTATACAAAATGCAGTGATGTAACGAAAATGTTCCCCAGTGATTAAAAAAAACAGTGCAGTCTACCATTCTGGTAATCAGAACATTTAGACTGATTCGAAAGGTTTTAAAGCAGAGGCTGCTGCAGGCATTTAGATTATATCACCGTAATCAAGTACTGAGAGAAGCGTTGCTTGAAAAATATTCCTTCTACTTTCCAAAG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU810503 lncRNA downstream 3845 45713546 ~ 45713820 (-) True G712969
TU810502 lncRNA downstream 4826 45712616 ~ 45712839 (-) True G712968
TU810501 lncRNA downstream 5262 45712095 ~ 45712403 (-) True G712967
TU810482 lncRNA downstream 6102 45657176 ~ 45711563 (-) False G712949
TU810481 lncRNA downstream 6102 45707902 ~ 45711563 (-) True G712949
TU810507 lncRNA upstream 406 45718282 ~ 45718499 (-) True G712973
TU810541 lncRNA upstream 45791 45763667 ~ 45767088 (-) True G712998
TU810545 lncRNA upstream 54253 45772129 ~ 45772379 (-) True G713002
TU810554 lncRNA upstream 66910 45784786 ~ 45785064 (-) True G713011
TU810595 lncRNA upstream 145610 45863486 ~ 45891714 (-) True G713049
XM_021612616.2 mRNA downstream 32673 45678859 ~ 45684992 (-) True nol7
XM_021612610.2 mRNA downstream 116101 45509081 ~ 45601564 (-) True retreg1
XM_021612611.2 mRNA downstream 171548 45509081 ~ 45546117 (-) False retreg1
XM_021612609.2 mRNA downstream 222564 45485018 ~ 45495101 (-) False znf622
XM_021612624.2 mRNA upstream 75372 45793248 ~ 45924729 (-) False amph
XM_021612626.2 mRNA upstream 75372 45793248 ~ 45924729 (-) False amph
XM_021612621.2 mRNA upstream 75372 45793248 ~ 45924730 (-) False amph
XM_021612622.2 mRNA upstream 75372 45793248 ~ 45924730 (-) False amph
XM_021612623.2 mRNA upstream 75372 45793248 ~ 45924730 (-) False amph
TU810338 other downstream 259417 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 1178161 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 2546583 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 2996966 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 5758052 39956961 ~ 39959613 (-) True slc22a16
TU811283 other upstream 593254 46311130 ~ 46325681 (-) True crfb16
TU811888 other upstream 1333591 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 1460548 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 2571066 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 2824415 48542291 ~ 48616523 (-) True dlg1l

Expression Profile


TU810506 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU810506 Expression in each Bioproject

Bar chart with 5 bars.
TU810506 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.