RNA id: TU811239



Basic Information


Item Value
RNA id TU811239
length 242
lncRNA type read_through
GC content 0.46
exon number 2
gene id G713660
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46254476 ~ 46339044 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atttgaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggttgttcagggtgatgagctgtgttgcttttacgccacacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaatgacacttt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU810845 lncRNA downstream 8047 46246065 ~ 46246429 (-) True G713293
TU810839 lncRNA downstream 12419 46241856 ~ 46242057 (-) True G713287
TU810763 lncRNA downstream 117538 46136731 ~ 46136938 (-) True G713211
TU810754 lncRNA downstream 132745 46121282 ~ 46121731 (-) True G713202
TU810755 lncRNA downstream 133655 46120054 ~ 46120821 (-) True G713203
TU811275 lncRNA upstream 15615 46354659 ~ 46424529 (-) True G713694
TU811319 lncRNA upstream 26381 46365425 ~ 46376646 (-) True G713736
TU811324 lncRNA upstream 42522 46381566 ~ 46387729 (-) True G713738
TU811328 lncRNA upstream 59972 46399016 ~ 46406912 (-) False G713742
TU811330 lncRNA upstream 59972 46399016 ~ 46406912 (-) False G713742
XM_021612637.2 mRNA downstream 13039 46163653 ~ 46241437 (-) True tmeff1a
XM_021612636.2 mRNA downstream 13041 46163653 ~ 46241435 (-) False tmeff1a
XM_021612635.2 mRNA downstream 120488 46122744 ~ 46133988 (-) True cavin4a
XM_021612634.2 mRNA downstream 180430 46061743 ~ 46074046 (-) False ift57
XM_036985501.1 mRNA upstream 49898 46388942 ~ 46395118 (-) False LOC110529956
XM_036985502.1 mRNA upstream 49898 46388942 ~ 46395118 (-) True LOC110529956
XM_021612647.2 mRNA upstream 68689 46407733 ~ 46417579 (-) True dusp28
XM_021612654.2 mRNA upstream 123581 46462625 ~ 46463692 (-) True sft2d3
XM_021612657.2 mRNA upstream 188606 46527650 ~ 46556891 (-) True si:ch1073-184j22.1
TU810338 other downstream 796228 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 1714972 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3083394 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 3533777 42719771 ~ 42720699 (-) True G709272
TU804129 other downstream 6294863 39956961 ~ 39959613 (-) True slc22a16
TU811888 other upstream 712423 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 839380 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1949898 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 2203247 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 2420868 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811239 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU811239 Expression in each Bioproject

Bar chart with 13 bars.
TU811239 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.