RNA id: TU811487



Basic Information


Item Value
RNA id TU811487
length 218
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G713887
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46629582 ~ 46629799 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CTTCCATTCCGGTTTCAGTGAGCATACCAAAGTAAGCTGAACGAAGCCGGTGATAGTAGATTTGTGGATGTTCATTTCGAGCTTGTCTGATATTGTTAGCAAACGAGCTATCGTGTTTGCGAGTCTCAGAACCACTGAATTCTATTTTCAAAACTGTGGCAAGTTTAGCATAGTCGTTTTGCACGTGTTGCTCTTGTAGACGGATGAACCTTGTCACG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811484 lncRNA downstream 2441 46626609 ~ 46627141 (-) True G713884
TU811470 lncRNA downstream 22266 46596479 ~ 46607316 (-) True G713870
TU811467 lncRNA downstream 34406 46594393 ~ 46595176 (-) True G713869
TU811446 lncRNA downstream 52082 46577291 ~ 46577500 (-) True G713851
TU811443 lncRNA downstream 54575 46574786 ~ 46575007 (-) True G713848
TU811489 lncRNA upstream 1727 46631526 ~ 46631850 (-) True G713889
TU811490 lncRNA upstream 3563 46633362 ~ 46633615 (-) True G713890
TU811491 lncRNA upstream 5875 46635674 ~ 46635925 (-) True G713891
TU811452 lncRNA upstream 18901 46648700 ~ 46719825 (-) True G713855
TU811565 lncRNA upstream 160786 46790585 ~ 46790895 (-) True G713962
XM_021612657.2 mRNA downstream 72691 46527650 ~ 46556891 (-) True si:ch1073-184j22.1
XM_021612654.2 mRNA downstream 165890 46462625 ~ 46463692 (-) True sft2d3
XM_021612647.2 mRNA downstream 212003 46407733 ~ 46417579 (-) True dusp28
XM_036985501.1 mRNA downstream 234464 46388942 ~ 46395118 (-) False LOC110529956
XM_036985506.1 mRNA upstream 22029 46651828 ~ 46760034 (-) False pex5lb
XM_021612661.2 mRNA upstream 22029 46651828 ~ 46803168 (-) False pex5lb
XM_036985507.1 mRNA upstream 22029 46651828 ~ 46803168 (-) False pex5lb
XM_036985508.1 mRNA upstream 22029 46651828 ~ 46803168 (-) False pex5lb
XM_036985505.1 mRNA upstream 22029 46651828 ~ 46803169 (-) True pex5lb
TU811283 other downstream 303901 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1171334 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2090078 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3458500 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 3908883 42719771 ~ 42720699 (-) True G709272
TU811888 other upstream 421668 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 548625 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1659143 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1912492 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 2130113 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811487 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU811487 Expression in each Bioproject

Bar chart with 10 bars.
TU811487 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.