RNA id: TU811489



Basic Information


Item Value
RNA id TU811489
length 325
lncRNA type inter_gene
GC content 0.50
exon number 1
gene id G713889
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46631526 ~ 46631850 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CTAGTGGTTAGTTCCAACAGCGGGTTGCCATTGATAGTTAGCCCCAAGTCGAATAGTTGCGGAGAGGGTTGGAAGAATGCAGTGGTGCCTTACATCCAGTATCCGGGAGCCAGGTTCAGTCTTACAGAAACCTCTGTGGTTCTTGCCGGAATCAACATAGCGGACTCAGTTATCACCTTGCAAGCTTCAGGAATAGTCTGCCCGGATGCCATTCGCACCGGGTTGAAAGACGAGGCATGTTGGTTTGGCTGCGCCAAAGACCAAAGAACTTGGTGTATGGTATCGAGTTTCAAACCCAATCTTACCAAAATGTCCGCTCCCACAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811487 lncRNA downstream 1727 46629582 ~ 46629799 (-) True G713887
TU811484 lncRNA downstream 4385 46626609 ~ 46627141 (-) True G713884
TU811470 lncRNA downstream 24210 46596479 ~ 46607316 (-) True G713870
TU811467 lncRNA downstream 36350 46594393 ~ 46595176 (-) True G713869
TU811446 lncRNA downstream 54026 46577291 ~ 46577500 (-) True G713851
TU811490 lncRNA upstream 1512 46633362 ~ 46633615 (-) True G713890
TU811491 lncRNA upstream 3824 46635674 ~ 46635925 (-) True G713891
TU811452 lncRNA upstream 16850 46648700 ~ 46719825 (-) True G713855
TU811565 lncRNA upstream 158735 46790585 ~ 46790895 (-) True G713962
TU811623 lncRNA upstream 218853 46850703 ~ 46851098 (-) True G714020
XM_021612657.2 mRNA downstream 74635 46527650 ~ 46556891 (-) True si:ch1073-184j22.1
XM_021612654.2 mRNA downstream 167834 46462625 ~ 46463692 (-) True sft2d3
XM_021612647.2 mRNA downstream 213947 46407733 ~ 46417579 (-) True dusp28
XM_036985501.1 mRNA downstream 236408 46388942 ~ 46395118 (-) False LOC110529956
XM_036985506.1 mRNA upstream 19978 46651828 ~ 46760034 (-) False pex5lb
XM_021612661.2 mRNA upstream 19978 46651828 ~ 46803168 (-) False pex5lb
XM_036985507.1 mRNA upstream 19978 46651828 ~ 46803168 (-) False pex5lb
XM_036985508.1 mRNA upstream 19978 46651828 ~ 46803168 (-) False pex5lb
XM_036985505.1 mRNA upstream 19978 46651828 ~ 46803169 (-) True pex5lb
TU811283 other downstream 305845 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1173278 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2092022 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3460444 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 3910827 42719771 ~ 42720699 (-) True G709272
TU811888 other upstream 419617 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 546574 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1657092 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1910441 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 2128062 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811489 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU811489 Expression in each Bioproject

Bar chart with 11 bars.
TU811489 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.