RNA id: TU811623



Basic Information


Item Value
RNA id TU811623
length 396
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G714020
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46850703 ~ 46851098 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cctaaatcaaatcaaatcaatttttttttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttatacacagtgtaaggggataaagaatatgtacataaggatatatgactgagtgatggtacagagcagcataggcaagatacagtagatggtatcgagtacagtatatgcatatgagatgagtatgtaaacaaagtggcatagttgaagtggctagtgatacatgtattacataaggatacagtcgatgatatagagtacagtatatacgtatgcatatgagatgaataatgtagggtaagtaacat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811565 lncRNA downstream 59808 46790585 ~ 46790895 (-) True G713962
TU811452 lncRNA downstream 130878 46648700 ~ 46719825 (-) True G713855
TU811491 lncRNA downstream 214778 46635674 ~ 46635925 (-) True G713891
TU811490 lncRNA downstream 217088 46633362 ~ 46633615 (-) True G713890
TU811489 lncRNA downstream 218853 46631526 ~ 46631850 (-) True G713889
TU811776 lncRNA upstream 10218 46861316 ~ 46861673 (-) True G714168
TU811798 lncRNA upstream 48326 46899424 ~ 46899756 (-) True G714190
TU811801 lncRNA upstream 52465 46903563 ~ 46903762 (-) True G714193
TU811808 lncRNA upstream 63166 46914264 ~ 46951738 (-) True G714200
TU811840 lncRNA upstream 112678 46963776 ~ 46964049 (-) True G714232
XM_036985505.1 mRNA downstream 47534 46651828 ~ 46803169 (-) True pex5lb
XM_021612661.2 mRNA downstream 47535 46651828 ~ 46803168 (-) False pex5lb
XM_036985507.1 mRNA downstream 47535 46651828 ~ 46803168 (-) False pex5lb
XM_036985508.1 mRNA downstream 47535 46651828 ~ 46803168 (-) False pex5lb
XM_036985506.1 mRNA downstream 90669 46651828 ~ 46760034 (-) False pex5lb
XM_021612671.2 mRNA upstream 164787 47015885 ~ 47027075 (-) False nebl
XR_002474465.2 mRNA upstream 166438 47017536 ~ 47027075 (-) True nebl
XM_021612670.2 mRNA upstream 176096 47027194 ~ 47035362 (-) True dnajc1
XM_021612673.2 mRNA upstream 199975 47051073 ~ 47057707 (-) False LOC110529973
XM_021612672.2 mRNA upstream 199975 47051073 ~ 47067973 (-) False LOC110529973
TU811283 other downstream 525022 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1392455 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2311199 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3679621 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 4130004 42719771 ~ 42720699 (-) True G709272
TU811888 other upstream 200369 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 327326 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1437844 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1691193 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1908814 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811623 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU811623 Expression in each Bioproject

Bar chart with 14 bars.
TU811623 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.