RNA id: TU811808



Basic Information


Item Value
RNA id TU811808
length 325
lncRNA type antisense_over
GC content 0.58
exon number 2
gene id G714200
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46914264 ~ 46951738 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gggaggtccgtggggcaacgcacaattggcctagcgtcgcccgggttagggagggcttggtcggtaggggtgtccttgtctcatcgcgcaccagcgactcctgtggcgggctgggcgcagtgtacgctaaccaaggtggaaaggtgcatggtgtttcctctggcgcattggtgcggctggcttccgggttggatgtgcgctgtgttaaagaagcagcggcttggttggttgtgtatcggaggacgcatgactttcaaccttcgtctctcccgagcccgtatgggagttgtagcgatgagacaagatagtagctactaacaattgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811801 lncRNA downstream 10502 46903563 ~ 46903762 (-) True G714193
TU811798 lncRNA downstream 14508 46899424 ~ 46899756 (-) True G714190
TU811776 lncRNA downstream 52591 46861316 ~ 46861673 (-) True G714168
TU811623 lncRNA downstream 63166 46850703 ~ 46851098 (-) True G714020
TU811565 lncRNA downstream 123369 46790585 ~ 46790895 (-) True G713962
TU811840 lncRNA upstream 12038 46963776 ~ 46964049 (-) True G714232
TU811843 lncRNA upstream 17464 46969202 ~ 46969837 (-) True G714235
TU811844 lncRNA upstream 18143 46969881 ~ 46973069 (-) True G714236
TU811849 lncRNA upstream 22307 46974045 ~ 46974336 (-) True G714240
TU811868 lncRNA upstream 44898 46996636 ~ 46996931 (-) True G714259
XM_036985505.1 mRNA downstream 111095 46651828 ~ 46803169 (-) True pex5lb
XM_021612661.2 mRNA downstream 111096 46651828 ~ 46803168 (-) False pex5lb
XM_036985507.1 mRNA downstream 111096 46651828 ~ 46803168 (-) False pex5lb
XM_036985508.1 mRNA downstream 111096 46651828 ~ 46803168 (-) False pex5lb
XM_036985506.1 mRNA downstream 154230 46651828 ~ 46760034 (-) False pex5lb
XM_021612671.2 mRNA upstream 64147 47015885 ~ 47027075 (-) False nebl
XR_002474465.2 mRNA upstream 65798 47017536 ~ 47027075 (-) True nebl
XM_021612670.2 mRNA upstream 75456 47027194 ~ 47035362 (-) True dnajc1
XM_021612673.2 mRNA upstream 99335 47051073 ~ 47057707 (-) False LOC110529973
XM_021612672.2 mRNA upstream 99335 47051073 ~ 47067973 (-) False LOC110529973
TU811283 other downstream 588583 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1456016 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2374760 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3743182 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 4193565 42719771 ~ 42720699 (-) True G709272
TU811888 other upstream 99729 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 226686 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1337204 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1590553 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1808174 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811808 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU811808 Expression in each Bioproject

Bar chart with 16 bars.
TU811808 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.