RNA id: TU811872



Basic Information


Item Value
RNA id TU811872
length 250
lncRNA type antisense_over
GC content 0.60
exon number 1
gene id G714263
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46998395 ~ 46998644 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGATTAAGTGAGTTGTTCTCCGAGGACTTGGTGGAGAGCAGGATGTGGGTGAAGCCATCCTGCTTCTTGACGACAAGGTCCCTGTAGCGGTAGGCACTCTCAGTCTGCCGGACGCTGAACCGAAGGCGCTTGTCGAAGACTGAGCGCTGCTCCTCGAAGCGCCGTTTCCCTGCCACCCCGGAGACTGGGGTGACTCCTGCCACTGCACTCTGCAGGCTAGCTGTCCCATTGGCCGCCAGAGCCTCCATGA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811868 lncRNA downstream 1464 46996636 ~ 46996931 (-) True G714259
TU811849 lncRNA downstream 24059 46974045 ~ 46974336 (-) True G714240
TU811844 lncRNA downstream 25326 46969881 ~ 46973069 (-) True G714236
TU811843 lncRNA downstream 28558 46969202 ~ 46969837 (-) True G714235
TU811840 lncRNA downstream 34346 46963776 ~ 46964049 (-) True G714232
TU811874 lncRNA upstream 1839 47000483 ~ 47000699 (-) True G714265
TU811875 lncRNA upstream 2401 47001045 ~ 47001685 (-) True G714266
TU811871 lncRNA upstream 5323 47003967 ~ 47010269 (-) True G714262
TU811880 lncRNA upstream 16955 47015599 ~ 47015811 (-) True G714271
TU811886 lncRNA upstream 37383 47036027 ~ 47036317 (-) True G714276
XM_036985505.1 mRNA downstream 195226 46651828 ~ 46803169 (-) True pex5lb
XM_021612661.2 mRNA downstream 195227 46651828 ~ 46803168 (-) False pex5lb
XM_036985507.1 mRNA downstream 195227 46651828 ~ 46803168 (-) False pex5lb
XM_036985508.1 mRNA downstream 195227 46651828 ~ 46803168 (-) False pex5lb
XM_036985506.1 mRNA downstream 238361 46651828 ~ 46760034 (-) False pex5lb
XM_021612671.2 mRNA upstream 17241 47015885 ~ 47027075 (-) False nebl
XR_002474465.2 mRNA upstream 18892 47017536 ~ 47027075 (-) True nebl
XM_021612670.2 mRNA upstream 28550 47027194 ~ 47035362 (-) True dnajc1
XM_021612673.2 mRNA upstream 52429 47051073 ~ 47057707 (-) False LOC110529973
XM_021612672.2 mRNA upstream 52429 47051073 ~ 47067973 (-) False LOC110529973
TU811283 other downstream 672714 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1540147 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2458891 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3827313 43170760 ~ 43171082 (-) True G709454
TU806574 other downstream 4277696 42719771 ~ 42720699 (-) True G709272
TU811888 other upstream 52823 47051467 ~ 47057660 (-) True LOC110529973
TU812043 other upstream 179780 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1290298 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1543647 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1761268 48759912 ~ 48761163 (-) True G716463

Expression Profile


TU811872 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

TU811872 Expression in each Bioproject

Bar chart with 3 bars.
TU811872 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.