RNA id: TU811910



Basic Information


Item Value
RNA id TU811910
length 230
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G714296
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47075860 ~ 47076089 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


acaaggtccacccttgcgcgtatttttctcatcgcctgtcgccgtcggaacgtaactatgatgtgggaaaccgcgaactgctcgccatccgcttagccctaggcgaatggcgacagtggttggaaggggcgaccgttccttttgtcgtttggactgaccataggaaccttgagtacatccgttctgccaaacgacttaatgcgcgtcaggctcgttgggctctgtttttc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811904 lncRNA downstream 6072 47069576 ~ 47069788 (-) True G714290
TU811892 lncRNA downstream 30364 47044762 ~ 47045496 (-) True G714279
TU811893 lncRNA downstream 30505 47044704 ~ 47045355 (-) False G714279
TU811886 lncRNA downstream 39543 47036027 ~ 47036317 (-) True G714276
TU811880 lncRNA downstream 60049 47015599 ~ 47015811 (-) True G714271
TU811912 lncRNA upstream 1672 47077761 ~ 47077967 (-) True G714298
TU811914 lncRNA upstream 3009 47079098 ~ 47079448 (-) True G714300
TU811932 lncRNA upstream 13426 47089515 ~ 47089752 (-) True G714318
TU811944 lncRNA upstream 25759 47101848 ~ 47102144 (-) True G714330
TU811951 lncRNA upstream 32246 47108335 ~ 47108690 (-) True G714337
XM_021612672.2 mRNA downstream 7887 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 18153 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 40498 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 48785 47015885 ~ 47027075 (-) False nebl
XM_021612689.2 mRNA upstream 153998 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 153998 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 153998 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 153998 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 153998 47230087 ~ 47260844 (-) False LOC110529976
TU811888 other downstream 18200 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 750179 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1617612 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2536356 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3904778 43170760 ~ 43171082 (-) True G709454
TU812043 other upstream 102335 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1212853 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1466202 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1683823 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1706032 48782121 ~ 48782515 (-) True G716480

Expression Profile


TU811910 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU811910 Expression in each Bioproject

Bar chart with 6 bars.
TU811910 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.