RNA id: TU811951



Basic Information


Item Value
RNA id TU811951
length 356
lncRNA type inter_gene
GC content 0.46
exon number 1
gene id G714337
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47108335 ~ 47108690 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tagcattcttcttgccaatgtccagtctcttgacaacaaggttgatgaaatccgagcaagggtagcattccagagggacatcagagactgtaacgttctttgcttcacggaaacgtggcttactggagagacgctatccgaagcggtgcagccaacaggtttctccacgcatcgcgcagacaggaaaaaaacatctttctggtaaaaagaggggcgggggcgtatgccttatgactaacgtgacatggtgcgatgaaagaaacatacaggaactcaaatccttctgttcacctgatttagaattcctcacaatcaaatgtagaccgcattatctaccaagagaattctcttcgatt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU811944 lncRNA downstream 6191 47101848 ~ 47102144 (-) True G714330
TU811932 lncRNA downstream 18583 47089515 ~ 47089752 (-) True G714318
TU811914 lncRNA downstream 28887 47079098 ~ 47079448 (-) True G714300
TU811912 lncRNA downstream 30368 47077761 ~ 47077967 (-) True G714298
TU811910 lncRNA downstream 32246 47075860 ~ 47076089 (-) True G714296
TU812007 lncRNA upstream 10053 47118743 ~ 47119430 (-) True G714393
TU812031 lncRNA upstream 55165 47163855 ~ 47164140 (-) True G714414
TU812036 lncRNA upstream 60637 47169327 ~ 47169929 (-) True G714418
TU812038 lncRNA upstream 63134 47171824 ~ 47172422 (-) True G714420
TU812039 lncRNA upstream 63919 47172609 ~ 47172872 (-) True G714421
XM_021612672.2 mRNA downstream 40362 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 50628 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 72973 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 81260 47015885 ~ 47027075 (-) False nebl
XM_021612689.2 mRNA upstream 121397 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 121397 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 121397 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 121397 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 121397 47230087 ~ 47260844 (-) False LOC110529976
TU811888 other downstream 50675 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 782654 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1650087 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2568831 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 3937253 43170760 ~ 43171082 (-) True G709454
TU812043 other upstream 69734 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1180252 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1433601 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1651222 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1673431 48782121 ~ 48782515 (-) True G716480

Expression Profile


TU811951 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU811951 Expression in each Bioproject

Bar chart with 19 bars.
TU811951 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.