RNA id: TU812041



Basic Information


Item Value
RNA id TU812041
length 224
lncRNA type antisense_over
GC content 0.52
exon number 1
gene id G714423
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47176799 ~ 47177022 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CCCAGGCTTAATGTACTTACCTTGCCTGGGAAAAAGGAACTGTTCTTGAACTTGCGCAGGTAAAACGCAATGAAGAACGTTCCGGACATTAGCACCAACGTCAGGAGGGCTGTGTTGGGCTCCCCCACCACCTTGCCAGGCACGCCAACCACAGTGTCGTTGCATGATGAGGATGTCCATGTGTCGTTGACCAGGTAACAGCGTTGGAGAGGATGCTCTTGAAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812040 lncRNA downstream 2791 47172988 ~ 47174008 (-) True G714422
TU812039 lncRNA downstream 3927 47172609 ~ 47172872 (-) True G714421
TU812038 lncRNA downstream 4377 47171824 ~ 47172422 (-) True G714420
TU812036 lncRNA downstream 6870 47169327 ~ 47169929 (-) True G714418
TU812031 lncRNA downstream 12659 47163855 ~ 47164140 (-) True G714414
TU812042 lncRNA upstream 697 47177719 ~ 47177947 (-) True G714424
TU812046 lncRNA upstream 14312 47191334 ~ 47191962 (-) True G714428
TU812047 lncRNA upstream 16335 47193357 ~ 47196528 (-) True G714429
TU812048 lncRNA upstream 20634 47197656 ~ 47198344 (-) True G714430
TU812053 lncRNA upstream 25630 47202652 ~ 47202881 (-) True G714435
XM_021612672.2 mRNA downstream 108826 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 119092 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 141437 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 149724 47015885 ~ 47027075 (-) False nebl
XM_021612689.2 mRNA upstream 53065 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 53065 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 53065 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 53065 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 53065 47230087 ~ 47260844 (-) False LOC110529976
TU811888 other downstream 119139 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 851118 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1718551 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2637295 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 4005717 43170760 ~ 43171082 (-) True G709454
TU812043 other upstream 1402 47178424 ~ 47178736 (-) True G714425
TU813564 other upstream 1111920 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1365269 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1582890 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1605099 48782121 ~ 48782515 (-) True G716480

Expression Profile


TU812041 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU812041 Expression in each Bioproject

Bar chart with 4 bars.
TU812041 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.