RNA id: TU812043



Basic Information


Item Value
RNA id TU812043
length 313
RNA type TUCP
GC content 0.58
exon number 1
gene id G714425
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47178424 ~ 47178736 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ATTTTGCGACCCTACTCTCGATTTAGTCCTGGGCACTAAGTTAGAGGGGTCATGCCTACCGACAAACAGAGCTACGAGGAAGCCCGTCACCCTCTGCTCTTTCACTTCATGGATACGGGGCTTGTCGCCGGGGGCCACCGCCTTGCTCATGACGGTAAGGGCGTTTGCGTGAGTAACAGAACGCACGGTGGCGGCGGCCAACCAGGGCAGACCGAACAGGGCCGAAACCCCACCTATGGCCACGATGATGAGCAGGTCCAGGTGGAAGCCGGAGCCCTTCAACAGCATCCGTTCCTTCTTACTGACTATCAGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812042 lncRNA downstream 477 47177719 ~ 47177947 (-) True G714424
TU812041 lncRNA downstream 1402 47176799 ~ 47177022 (-) True G714423
TU812040 lncRNA downstream 4416 47172988 ~ 47174008 (-) True G714422
TU812039 lncRNA downstream 5552 47172609 ~ 47172872 (-) True G714421
TU812038 lncRNA downstream 6002 47171824 ~ 47172422 (-) True G714420
TU812046 lncRNA upstream 12598 47191334 ~ 47191962 (-) True G714428
TU812047 lncRNA upstream 14621 47193357 ~ 47196528 (-) True G714429
TU812048 lncRNA upstream 18920 47197656 ~ 47198344 (-) True G714430
TU812053 lncRNA upstream 23916 47202652 ~ 47202881 (-) True G714435
TU812058 lncRNA upstream 29243 47207979 ~ 47208345 (-) True G714440
XM_021612672.2 mRNA downstream 110451 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 120717 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 143062 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 151349 47015885 ~ 47027075 (-) False nebl
XR_002474465.2 mRNA downstream 151349 47017536 ~ 47027075 (-) True nebl
XM_021612689.2 mRNA upstream 51351 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 51351 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 51351 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 51351 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 51351 47230087 ~ 47260844 (-) False LOC110529976
TU811888 other downstream 120764 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 852743 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1720176 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2638920 44538793 ~ 44539504 (-) True G711133
TU806781 other downstream 4007342 43170760 ~ 43171082 (-) True G709454
TU813564 other upstream 1110206 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1363555 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1581176 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1603385 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 1609785 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU812043 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU812043 Expression in each Bioproject

Bar chart with 7 bars.
TU812043 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.