RNA id: TU812048



Basic Information


Item Value
RNA id TU812048
length 689
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G714430
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47197656 ~ 47198344 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gcacatgtttattttttatttttttatttcacctttatttaaccaggtaggcaagttgagaacaagttctaatttacaattgcgacctggccaagataaagcaaagcagttcgacacatacaacgacagagttacacatggagtaaaacaaacatacagtcaataatacagtataaacaagtctacatacgatgtgagcaaatgaggtgagataagggaggtaaaggcaaaaaaggccatggtggcaaagtaaatacaatatagcaagtaaaacactggaatggtagatttgcaatggaagaatgtgcaaagtagaaataaaaataacggggtgcaaaggagcaaaataaatacattaattaaatacagtagggaaagaggtagttgtttgggctaaattataggtgggctatgtacaggtgcagtaatctgtgagctgctctgacagttggtgcttaaagctagtgagggagataagtgtttccagtttcagagattttggtagttcgttccagtcattggcagcagagaactggaaggagaggcaaccaaagaaagaattggttttgggggtgactagagagatatacctgctggagcgtgtgctacaggtgggagatgctatggtgaccagcgagctgagataaggggggactttacctagcagggtcttgtagatgacatggagc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812047 lncRNA downstream 1128 47193357 ~ 47196528 (-) True G714429
TU812046 lncRNA downstream 5694 47191334 ~ 47191962 (-) True G714428
TU812042 lncRNA downstream 19709 47177719 ~ 47177947 (-) True G714424
TU812041 lncRNA downstream 20634 47176799 ~ 47177022 (-) True G714423
TU812040 lncRNA downstream 23648 47172988 ~ 47174008 (-) True G714422
TU812053 lncRNA upstream 4308 47202652 ~ 47202881 (-) True G714435
TU812058 lncRNA upstream 9635 47207979 ~ 47208345 (-) True G714440
TU812331 lncRNA upstream 30423 47228767 ~ 47229293 (-) True G714689
TU812329 lncRNA upstream 31781 47230125 ~ 47233488 (-) True LOC110529976
TU812411 lncRNA upstream 153849 47352193 ~ 47388487 (-) True G714764
XM_021612672.2 mRNA downstream 129683 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 139949 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 162294 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 170581 47015885 ~ 47027075 (-) False nebl
XM_021612689.2 mRNA upstream 31743 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 31743 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 31743 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 31743 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 31743 47230087 ~ 47260844 (-) False LOC110529976
TU812043 other downstream 18920 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 139996 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 871975 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1739408 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2658152 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 1090598 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1343947 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1561568 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1583777 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 1590177 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU812048 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

TU812048 Expression in each Bioproject

Bar chart with 20 bars.
TU812048 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.