RNA id: TU812053



Basic Information


Item Value
RNA id TU812053
length 230
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G714435
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47202652 ~ 47202881 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


caccagtctgctgttcccacatgcttcaagagggccaccattgttcccgttcccaagaaagctaaggtaactgagctaaacgactaccaccccgtagcactcacttccgtcatcatgaagtgctttgagagactagtcaaggaccatatcacctctaccctacccgacaccctagacccactccaatttgcttaccgcccaaataggtccacagacgatgcaatctcaac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812048 lncRNA downstream 4308 47197656 ~ 47198344 (-) True G714430
TU812047 lncRNA downstream 6124 47193357 ~ 47196528 (-) True G714429
TU812046 lncRNA downstream 10690 47191334 ~ 47191962 (-) True G714428
TU812042 lncRNA downstream 24705 47177719 ~ 47177947 (-) True G714424
TU812041 lncRNA downstream 25630 47176799 ~ 47177022 (-) True G714423
TU812058 lncRNA upstream 5098 47207979 ~ 47208345 (-) True G714440
TU812331 lncRNA upstream 25886 47228767 ~ 47229293 (-) True G714689
TU812329 lncRNA upstream 27244 47230125 ~ 47233488 (-) True LOC110529976
TU812411 lncRNA upstream 149312 47352193 ~ 47388487 (-) True G714764
TU812473 lncRNA upstream 248576 47451457 ~ 47451848 (-) True G714816
XM_021612672.2 mRNA downstream 134679 47051073 ~ 47067973 (-) False LOC110529973
XM_021612673.2 mRNA downstream 144945 47051073 ~ 47057707 (-) False LOC110529973
XM_021612670.2 mRNA downstream 167290 47027194 ~ 47035362 (-) True dnajc1
XM_021612671.2 mRNA downstream 175577 47015885 ~ 47027075 (-) False nebl
XM_021612689.2 mRNA upstream 27206 47230087 ~ 47260839 (-) False LOC110529976
XM_021612686.2 mRNA upstream 27206 47230087 ~ 47260840 (-) False LOC110529976
XM_021612688.2 mRNA upstream 27206 47230087 ~ 47260840 (-) False LOC110529976
XM_021612685.2 mRNA upstream 27206 47230087 ~ 47260844 (-) False LOC110529976
XM_021612687.2 mRNA upstream 27206 47230087 ~ 47260844 (-) False LOC110529976
TU812043 other downstream 23916 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 144992 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 876971 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1744404 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2663148 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 1086061 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1339410 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1557031 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1579240 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 1585640 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU812053 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU812053 Expression in each Bioproject

Bar chart with 16 bars.
TU812053 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.