RNA id: TU812411



Basic Information


Item Value
RNA id TU812411
length 292
lncRNA type antisense_over
GC content 0.38
exon number 2
gene id G714764
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47352193 ~ 47388487 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


attttgcacgcccaatttttcagtttttgatttgttaaaaaagtatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaagggggccaaatactttcgcaaggcactgtaatgactcaggagtgtgaatacttacagtggggcaaaaaagtatttagtccgccaccaattgtgtaggttctcccacttaaaaagatgagaggcctgtacttttcatcataggtacacttcaactatgacagacaaaatgagggaaaaaaatccagaaaatcacattgtagaatttt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812329 lncRNA downstream 118705 47230125 ~ 47233488 (-) True LOC110529976
TU812331 lncRNA downstream 122900 47228767 ~ 47229293 (-) True G714689
TU812058 lncRNA downstream 143848 47207979 ~ 47208345 (-) True G714440
TU812053 lncRNA downstream 149312 47202652 ~ 47202881 (-) True G714435
TU812048 lncRNA downstream 153849 47197656 ~ 47198344 (-) True G714430
TU812473 lncRNA upstream 62970 47451457 ~ 47451848 (-) True G714816
TU812480 lncRNA upstream 77338 47465825 ~ 47466150 (-) True G714823
TU812512 lncRNA upstream 133293 47521780 ~ 47522040 (-) True G714855
TU812533 lncRNA upstream 144512 47532999 ~ 47533347 (-) True G714876
TU812708 lncRNA upstream 279482 47667969 ~ 47673891 (-) True G715048
XM_036985518.1 mRNA downstream 48274 47298295 ~ 47303919 (-) True LOC110529978
XM_036985517.1 mRNA downstream 48293 47298295 ~ 47303900 (-) False LOC110529978
XM_021612691.2 mRNA downstream 56885 47283739 ~ 47295308 (-) True LOC110529977
XM_021612692.2 mRNA downstream 56890 47283739 ~ 47295303 (-) False LOC110529977
XM_021612690.2 mRNA downstream 91341 47230087 ~ 47260852 (-) False LOC110529976
XM_021612696.2 mRNA upstream 9296 47397783 ~ 47439942 (-) False LOC110529981
XM_021612697.2 mRNA upstream 9296 47397783 ~ 47439942 (-) False LOC110529981
XR_005052883.1 mRNA upstream 9296 47397783 ~ 47439942 (-) False LOC110529981
XR_005052884.1 mRNA upstream 9296 47397783 ~ 47439942 (-) False LOC110529981
XR_005052885.1 mRNA upstream 9296 47397783 ~ 47439942 (-) False LOC110529981
TU812043 other downstream 173457 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 294533 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1026512 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 1893945 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 2812689 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 900455 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 1153804 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1371425 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1393634 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 1400034 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU812411 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU812411 Expression in each Bioproject

Bar chart with 14 bars.
TU812411 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.