RNA id: TU812768



Basic Information


Item Value
RNA id TU812768
length 484
lncRNA type inter_gene
GC content 0.34
exon number 1
gene id G715105
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47719750 ~ 47720233 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


actccagccactttaataatgggaattgatgggaaatgacgtaaatatatcactagccactttaaacaatgctaccttatataaatgttacttaccctacattattcatctcatatgcatacgtatatactgtactctatatcatcgacggtatccttatgtaatacatgtatcactagccactttatactatactatgccactttttttacatactcatctcatttgtacatactgtactcgataccatctactgtatcttgcctatgctgctctgtaccatcactcattcatatatccttatgtacatattctttatccccttacactgtgtacaagacagtagttttggaattgttagttagattacttgttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcactaacatctgctaaccatgtgtatgtgacaaatacaatttgatttgatttgatttgattt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU812758 lncRNA downstream 4967 47714582 ~ 47714783 (-) True G715095
TU812751 lncRNA downstream 11797 47707647 ~ 47707953 (-) True G715088
TU812750 lncRNA downstream 12166 47707353 ~ 47707584 (-) True G715087
TU812746 lncRNA downstream 15280 47704219 ~ 47704470 (-) True G715083
TU812739 lncRNA downstream 21878 47697587 ~ 47697872 (-) True G715079
TU812770 lncRNA upstream 581 47720814 ~ 47721174 (-) True G715107
TU812773 lncRNA upstream 1836 47722069 ~ 47722312 (-) True G715110
TU812774 lncRNA upstream 2326 47722559 ~ 47722797 (-) True G715111
TU812778 lncRNA upstream 4801 47725034 ~ 47725335 (-) True G715115
TU812942 lncRNA upstream 6838 47727071 ~ 47728355 (-) False LOC110529987
XR_002474329.2 mRNA downstream 63682 47655052 ~ 47656068 (-) True LOC110529117
XR_005052884.1 mRNA downstream 279808 47397783 ~ 47439942 (-) False LOC110529981
XM_021612703.2 mRNA upstream 6557 47726790 ~ 47894176 (-) False LOC110529987
XM_021612708.2 mRNA upstream 609451 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 635771 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 635771 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 635771 48356004 ~ 48486048 (-) False dlg1l
TU812043 other downstream 541014 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 662090 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1394069 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2261502 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 3180246 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 568709 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 822058 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 1039679 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 1061888 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 1068288 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU812768 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU812768 Expression in each Bioproject

Bar chart with 19 bars.
TU812768 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.