RNA id: TU813256



Basic Information


Item Value
RNA id TU813256
length 368
lncRNA type inter_gene
GC content 0.52
exon number 1
gene id G715581
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48074163 ~ 48074530 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tccagggccacctctcttcctccacaccggtcgtatgattgtagtattgatctccttccgggaaccactcccccccggggtagactatactctctgtcggctcccgaacgtaaggctctcaaagattatttgtctgtagctcttgacgccggtaccatagtcccctcctcctctcccgccggagcggggttttttttttgtcaagaagaaggacgggtctctgcgcccctgcatagattatcgagggctgaatgacataacagtgaagaatcgttatccgcttcctcttatgtcttcagccttcgagatcctgcagggagccaggtttttcactaagttggaccttcgtaacgcttaccatctcgtgc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU813253 lncRNA downstream 1859 48071971 ~ 48072304 (-) True G715578
TU813247 lncRNA downstream 8132 48065799 ~ 48066031 (-) True G715572
TU813240 lncRNA downstream 15499 48058427 ~ 48058664 (-) True G715565
TU813238 lncRNA downstream 16775 48057168 ~ 48057388 (-) True G715563
TU813141 lncRNA downstream 84799 47989026 ~ 47989364 (-) True G715467
TU813260 lncRNA upstream 1340 48075870 ~ 48076171 (-) True G715585
TU813321 lncRNA upstream 37184 48111714 ~ 48113292 (-) True G715645
TU813301 lncRNA upstream 44785 48119315 ~ 48120151 (-) True G715625
TU813395 lncRNA upstream 89200 48163730 ~ 48164225 (-) True G715717
TU813393 lncRNA upstream 93244 48167774 ~ 48168935 (-) True G715715
XM_021612703.2 mRNA downstream 179987 47726790 ~ 47894176 (-) False LOC110529987
XR_002474329.2 mRNA downstream 418095 47655052 ~ 47656068 (-) True LOC110529117
XR_005052885.1 mRNA downstream 634221 47397783 ~ 47439942 (-) False LOC110529981
XM_021612708.2 mRNA upstream 255154 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 281474 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 281474 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 281474 48356004 ~ 48486048 (-) False dlg1l
XM_021612729.2 mRNA upstream 281474 48356004 ~ 48515295 (-) False dlg1l
TU812043 other downstream 895427 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 1016503 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1748482 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2615915 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 3534659 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 214412 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 467761 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 685382 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 707591 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 713991 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU813256 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU813256 Expression in each Bioproject

Bar chart with 21 bars.
TU813256 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.