RNA id: TU813516



Basic Information


Item Value
RNA id TU813516
length 296
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G715824
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48257722 ~ 48258017 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tttcaaatcaaatcaaatttattttatatagcccttcgtacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaaccccaaacagcaagcaatgcaggtgaagaagcacggtggctaggaaaaaactccctagaaaggccaaaacctaggaagaaacctagagaggaaccaggctatgtggggtggccagtcctcttctggctgtgccgggtggagattataacaaaacatggtcaagatgttcaaatgttcataaatgaccagcatggtcgaataataataaggc

Function


GO: NA

KEGG:

id description

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU813477 lncRNA downstream 27520 48221706 ~ 48230202 (-) False G715789
TU813478 lncRNA downstream 27520 48221706 ~ 48230202 (-) False G715789
TU813479 lncRNA downstream 27520 48221706 ~ 48230202 (-) False G715789
TU813480 lncRNA downstream 27520 48221706 ~ 48230202 (-) False G715789
TU813481 lncRNA downstream 27520 48221706 ~ 48230202 (-) True G715789
TU813552 lncRNA upstream 27874 48285891 ~ 48286307 (-) True G715860
TU813561 lncRNA upstream 29015 48287032 ~ 48287824 (-) True G715862
TU813991 lncRNA upstream 40548 48298565 ~ 48298788 (-) True G716253
TU813999 lncRNA upstream 50169 48308186 ~ 48308467 (-) True G716261
TU814023 lncRNA upstream 88826 48346843 ~ 48347043 (-) True G716285
XM_021612703.2 mRNA downstream 363546 47726790 ~ 47894176 (-) False LOC110529987
XR_002474329.2 mRNA downstream 601654 47655052 ~ 47656068 (-) True LOC110529117
XR_005052885.1 mRNA downstream 817780 47397783 ~ 47439942 (-) False LOC110529981
XM_021612708.2 mRNA upstream 71667 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 97987 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 97987 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 97987 48356004 ~ 48486048 (-) False dlg1l
XM_021612729.2 mRNA upstream 97987 48356004 ~ 48515295 (-) False dlg1l
TU812043 other downstream 1078986 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 1200062 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1932041 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2799474 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 3718218 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 30925 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 284274 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 501895 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 524104 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 530504 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU813516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU813516 Expression in each Bioproject

Bar chart with 14 bars.
TU813516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.