RNA id: TU813552



Basic Information


Item Value
RNA id TU813552
length 417
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G715860
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48285891 ~ 48286307 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


agaggagttgggttccctctcgggacgtgctggaccgtgcgctgattgatgatttcctccgttgccgccaggtttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtactgtcatgttgtcttgtctctgtcctttcccttcactctgtctccctctgctggtcgtgttaggttaccttttctcccccgctttcccccagctgtcccttgtctcctctaactacccattcaccccgttccccacctgttccctttttccctctgattaggtccctatatctctctctgtttctgctcctgtccttgtcggattcttgtttgtttgtgtcattcatgcctgaaccagactgccgtcatgtttgctgtaaccttgtcctgtcctgtcggaatctgccgg

Function


GO: NA

KEGG:

id description

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU813516 lncRNA downstream 27874 48257722 ~ 48258017 (-) True G715824
TU813477 lncRNA downstream 55689 48221706 ~ 48230202 (-) False G715789
TU813561 lncRNA upstream 725 48287032 ~ 48287824 (-) True G715862
TU813991 lncRNA upstream 12258 48298565 ~ 48298788 (-) True G716253
TU813999 lncRNA upstream 21879 48308186 ~ 48308467 (-) True G716261
TU814023 lncRNA upstream 60536 48346843 ~ 48347043 (-) True G716285
TU814026 lncRNA upstream 63291 48349598 ~ 48349811 (-) True G716288
XM_021612703.2 mRNA downstream 391715 47726790 ~ 47894176 (-) False LOC110529987
XR_002474329.2 mRNA downstream 629823 47655052 ~ 47656068 (-) True LOC110529117
XR_005052885.1 mRNA downstream 845949 47397783 ~ 47439942 (-) False LOC110529981
XM_021612708.2 mRNA upstream 43377 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 69697 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 69697 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 69697 48356004 ~ 48486048 (-) False dlg1l
XM_021612729.2 mRNA upstream 69697 48356004 ~ 48515295 (-) False dlg1l
TU812043 other downstream 1107155 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 1228231 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1960210 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2827643 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 3746387 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 2635 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 255984 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 473605 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 495814 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 502214 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU813552 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU813552 Expression in each Bioproject

Bar chart with 20 bars.
TU813552 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.