RNA id: TU813561



Basic Information


Item Value
RNA id TU813561
length 793
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G715862
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48287032 ~ 48287824 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttccttttgtcgtttggactgaccataggaaccttgagtacatccgttctgccaaacgacttaatgcgcgtcaggcgcgttgggcgctgtttttcgctcgtttcgagttcgtgatttcttatcgtccgggctctaagaacaccaagcctgatgctttgtctcgtctcttcagttcttcagtagcctccactgaccccgaggggattctccctgaggggcgtgttgtcgggttgactgtctggggaattgagaggcaggtaaagcaagcactcactcaaactccgtcgccgcgcgcttgtcctaggaaccttcttttcgttcccgttcctattcgtctggccgttcttcagtgggctcactctgccaagttagccggccaccctggcgttcggggtacgcttgcttccattcgccagcgtttctggtggcccacccgggagcatgacacgcgtcgtttcgtggctgcttgttcggtctgcgcgcagactaagtccggtaactctcctcctgccggccgtctcaggccgcttcctattccctctcgaccgtggtctcacatcgccttagattttgtcaccggactgccttcgtcagcggggaagactgttattcttacggttgtcgataggttctctaaggcggctcatttcattccccttgctaagcttccttctgctaaagagacggcacaaatcatcatcaagaatgttttcagaattcatggccttccgtcagacgtcgtttcggacagaggtccgcaattcacgtctcaattttggagggagttttgcc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU813552 lncRNA downstream 725 48285891 ~ 48286307 (-) True G715860
TU813516 lncRNA downstream 29015 48257722 ~ 48258017 (-) True G715824
TU813478 lncRNA downstream 56830 48221706 ~ 48230202 (-) False G715789
TU813991 lncRNA upstream 10741 48298565 ~ 48298788 (-) True G716253
TU813999 lncRNA upstream 20362 48308186 ~ 48308467 (-) True G716261
TU814023 lncRNA upstream 59019 48346843 ~ 48347043 (-) True G716285
TU814026 lncRNA upstream 61774 48349598 ~ 48349811 (-) True G716288
TU814027 lncRNA upstream 62543 48350367 ~ 48350566 (-) True G716289
XM_021612703.2 mRNA downstream 392856 47726790 ~ 47894176 (-) False LOC110529987
XR_002474329.2 mRNA downstream 630964 47655052 ~ 47656068 (-) True LOC110529117
XR_005052885.1 mRNA downstream 847090 47397783 ~ 47439942 (-) False LOC110529981
XM_021612708.2 mRNA upstream 41860 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 68180 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 68180 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 68180 48356004 ~ 48486048 (-) False dlg1l
XM_021612729.2 mRNA upstream 68180 48356004 ~ 48515295 (-) False dlg1l
TU812043 other downstream 1108296 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 1229372 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1961351 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2828784 45457777 ~ 45458248 (-) True G712814
TU808567 other downstream 3747528 44538793 ~ 44539504 (-) True G711133
TU813564 other upstream 1118 48288942 ~ 48289581 (-) True G715865
TU813956 other upstream 254467 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 472088 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 494297 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 500697 48788521 ~ 48788962 (-) True G716488

Expression Profile


TU813561 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU813561 Expression in each Bioproject

Bar chart with 18 bars.
TU813561 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.