RNA id: TU813999



Basic Information


Item Value
RNA id TU813999
length 282
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G716261
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48308186 ~ 48308467 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


caaaagtttatctcaatactttgttatataccctttgttggcaatgacagaggtcaaacgttttctgtaagtcttcacaaggttttcacacactgttgctggtattttggcccattcctccatgcagatctcctctagagcagtgatgttttgggactgttgctgggcaacacagactttcaactccctccaaagattttctatggggttgagatctggagactggctaggccactccaggaccttgaaatgcttcttacgaagccactccttcgttgcccg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU813991 lncRNA downstream 9398 48298565 ~ 48298788 (-) True G716253
TU813561 lncRNA downstream 20362 48287032 ~ 48287824 (-) True G715862
TU813552 lncRNA downstream 21879 48285891 ~ 48286307 (-) True G715860
TU813516 lncRNA downstream 50169 48257722 ~ 48258017 (-) True G715824
TU813480 lncRNA downstream 77984 48221706 ~ 48230202 (-) False G715789
TU814023 lncRNA upstream 38376 48346843 ~ 48347043 (-) True G716285
TU814026 lncRNA upstream 41131 48349598 ~ 48349811 (-) True G716288
TU814027 lncRNA upstream 41900 48350367 ~ 48350566 (-) True G716289
TU813969 lncRNA upstream 223064 48531531 ~ 48536356 (-) True LOC118965521
TU814141 lncRNA upstream 350880 48659347 ~ 48659569 (-) True G716401
XM_021612703.2 mRNA downstream 414010 47726790 ~ 47894176 (-) False LOC110529987
XR_002474329.2 mRNA downstream 652118 47655052 ~ 47656068 (-) True LOC110529117
XR_005052885.1 mRNA downstream 868244 47397783 ~ 47439942 (-) False LOC110529981
XM_021612708.2 mRNA upstream 21217 48329684 ~ 48343010 (-) True LOC110529989
XM_036985531.1 mRNA upstream 47537 48356004 ~ 48429216 (-) False dlg1l
XM_036985532.1 mRNA upstream 47537 48356004 ~ 48429216 (-) False dlg1l
XM_021612717.2 mRNA upstream 47537 48356004 ~ 48486048 (-) False dlg1l
XM_021612729.2 mRNA upstream 47537 48356004 ~ 48515295 (-) False dlg1l
TU813564 other downstream 18605 48288942 ~ 48289581 (-) True G715865
TU812043 other downstream 1129450 47178424 ~ 47178736 (-) True G714425
TU811888 other downstream 1250526 47051467 ~ 47057660 (-) True LOC110529973
TU811283 other downstream 1982505 46311130 ~ 46325681 (-) True crfb16
TU810338 other downstream 2849938 45457777 ~ 45458248 (-) True G712814
TU813956 other upstream 233824 48542291 ~ 48616523 (-) True dlg1l
TU814203 other upstream 451445 48759912 ~ 48761163 (-) True G716463
TU814220 other upstream 473654 48782121 ~ 48782515 (-) True G716480
TU814229 other upstream 480054 48788521 ~ 48788962 (-) True G716488
TU816366 other upstream 1477207 49785674 ~ 49837696 (-) True G718489

Expression Profile


TU813999 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU813999 Expression in each Bioproject

Bar chart with 21 bars.
TU813999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.