RNA id: TU814250



Basic Information


Item Value
RNA id TU814250
length 551
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G716509
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48827976 ~ 48828526 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccataaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgggcatggtgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttcgtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctattgacagagtctcccacctcagctgtagatctctgcagtcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU814237 lncRNA downstream 21723 48803552 ~ 48806253 (-) True G716496
TU814224 lncRNA downstream 42757 48784921 ~ 48785219 (-) True G716484
TU814223 lncRNA downstream 43153 48784415 ~ 48784823 (-) True G716483
TU814210 lncRNA downstream 57147 48770614 ~ 48770829 (-) True G716470
TU814206 lncRNA downstream 64363 48763327 ~ 48763613 (-) True G716466
TU814253 lncRNA upstream 4677 48833203 ~ 48833545 (-) True G716512
TU814254 lncRNA upstream 5169 48833695 ~ 48833915 (-) True G716513
TU814270 lncRNA upstream 28373 48856899 ~ 48857104 (-) True G716529
TU814284 lncRNA upstream 36522 48865048 ~ 48865299 (-) True G716543
TU814301 lncRNA upstream 48971 48877497 ~ 48877719 (-) True G716560
XM_021612710.2 mRNA downstream 211388 48356004 ~ 48616588 (-) False dlg1l
XM_021612715.2 mRNA downstream 211433 48356004 ~ 48616543 (-) False dlg1l
XM_021612739.2 mRNA upstream 293523 49122049 ~ 49140272 (-) False LOC110529994
XM_021612740.2 mRNA upstream 293523 49122049 ~ 49140273 (-) False LOC110529994
XM_021612741.2 mRNA upstream 293523 49122049 ~ 49140712 (-) True LOC110529994
XR_005053034.1 mRNA upstream 568273 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 614182 49442708 ~ 49490744 (-) False LOC110529999
TU814229 other downstream 39014 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 45461 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 66813 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 211453 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 538395 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 957148 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 1038104 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 2108402 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 2423829 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3932513 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU814250 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU814250 Expression in each Bioproject

Bar chart with 20 bars.
TU814250 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.