RNA id: TU814254



Basic Information


Item Value
RNA id TU814254
length 221
lncRNA type inter_gene
GC content 0.49
exon number 1
gene id G716513
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48833695 ~ 48833915 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTACCCCCGTCTGTGTCCGCCACATCGCTTGCCTCTCTTCCTAGACTTGTTGTTGATGATCTAGTCCTAGGTAGACTTTCAAGACCGGAATGGTTAAAAGAGCGCAACATACCGTGCTAGCCAGGTTGGCTAACTCATCGATGCAAGCTAGATATTACTAGCTATTCCTGCCTCCCCACAGTGGAGTTGCTGGGGTAGGTCTCTTGTTTAGTATACATTGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU814253 lncRNA downstream 150 48833203 ~ 48833545 (-) True G716512
TU814250 lncRNA downstream 5169 48827976 ~ 48828526 (-) True G716509
TU814237 lncRNA downstream 27442 48803552 ~ 48806253 (-) True G716496
TU814224 lncRNA downstream 48476 48784921 ~ 48785219 (-) True G716484
TU814223 lncRNA downstream 48872 48784415 ~ 48784823 (-) True G716483
TU814270 lncRNA upstream 22984 48856899 ~ 48857104 (-) True G716529
TU814284 lncRNA upstream 31133 48865048 ~ 48865299 (-) True G716543
TU814301 lncRNA upstream 43582 48877497 ~ 48877719 (-) True G716560
TU814997 lncRNA upstream 225832 49059747 ~ 49114775 (-) True G717227
TU815054 lncRNA upstream 313652 49147567 ~ 49147789 (-) True G717282
XM_021612710.2 mRNA downstream 217107 48356004 ~ 48616588 (-) False dlg1l
XM_021612715.2 mRNA downstream 217152 48356004 ~ 48616543 (-) False dlg1l
XM_021612739.2 mRNA upstream 288134 49122049 ~ 49140272 (-) False LOC110529994
XM_021612740.2 mRNA upstream 288134 49122049 ~ 49140273 (-) False LOC110529994
XM_021612741.2 mRNA upstream 288134 49122049 ~ 49140712 (-) True LOC110529994
XR_005053034.1 mRNA upstream 562884 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 608793 49442708 ~ 49490744 (-) False LOC110529999
TU814229 other downstream 44733 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 51180 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 72532 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 217172 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 544114 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 951759 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 1032715 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 2103013 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 2418440 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3927124 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU814254 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU814254 Expression in each Bioproject

Bar chart with 4 bars.
TU814254 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.