RNA id: TU814284



Basic Information


Item Value
RNA id TU814284
length 252
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G716543
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48865048 ~ 48865299 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cgctagatgtcctctttcattagagctttgaatcgttcaaatcccgcgagaattgaccctatgggagtgaaattagtgcgtgccacgagagaataggctgtgcgtatgggcgcgaattggtcccagccattcctttgttccagcactcaagagaagagcagacgatggccgattgaattgatgttttgcgtgtctaaaacatcataaagcttgcttctgcacttagtttgacctgtttagtcgacatataat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU814270 lncRNA downstream 7944 48856899 ~ 48857104 (-) True G716529
TU814254 lncRNA downstream 31133 48833695 ~ 48833915 (-) True G716513
TU814253 lncRNA downstream 31503 48833203 ~ 48833545 (-) True G716512
TU814250 lncRNA downstream 36522 48827976 ~ 48828526 (-) True G716509
TU814237 lncRNA downstream 58795 48803552 ~ 48806253 (-) True G716496
TU814301 lncRNA upstream 12198 48877497 ~ 48877719 (-) True G716560
TU814997 lncRNA upstream 194448 49059747 ~ 49114775 (-) True G717227
TU815054 lncRNA upstream 282268 49147567 ~ 49147789 (-) True G717282
TU815061 lncRNA upstream 290672 49155971 ~ 49156225 (-) True G717289
TU815063 lncRNA upstream 291929 49157228 ~ 49157718 (-) True G717291
XM_021612710.2 mRNA downstream 248460 48356004 ~ 48616588 (-) False dlg1l
XM_021612715.2 mRNA downstream 248505 48356004 ~ 48616543 (-) False dlg1l
XM_021612739.2 mRNA upstream 256750 49122049 ~ 49140272 (-) False LOC110529994
XM_021612740.2 mRNA upstream 256750 49122049 ~ 49140273 (-) False LOC110529994
XM_021612741.2 mRNA upstream 256750 49122049 ~ 49140712 (-) True LOC110529994
XR_005053034.1 mRNA upstream 531500 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 577409 49442708 ~ 49490744 (-) False LOC110529999
TU814229 other downstream 76086 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 82533 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 103885 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 248525 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 575467 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 920375 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 1001331 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 2071629 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 2387056 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3895740 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU814284 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU814284 Expression in each Bioproject

Bar chart with 10 bars.
TU814284 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.