RNA id: TU814997



Basic Information


Item Value
RNA id TU814997
length 429
lncRNA type inter_gene
GC content 0.43
exon number 2
gene id G717227
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49059747 ~ 49114775 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccattaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttcgtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU814301 lncRNA downstream 182028 48877497 ~ 48877719 (-) True G716560
TU814284 lncRNA downstream 194448 48865048 ~ 48865299 (-) True G716543
TU814270 lncRNA downstream 202643 48856899 ~ 48857104 (-) True G716529
TU814254 lncRNA downstream 225832 48833695 ~ 48833915 (-) True G716513
TU814253 lncRNA downstream 226202 48833203 ~ 48833545 (-) True G716512
TU815054 lncRNA upstream 32792 49147567 ~ 49147789 (-) True G717282
TU815061 lncRNA upstream 41196 49155971 ~ 49156225 (-) True G717289
TU815063 lncRNA upstream 42453 49157228 ~ 49157718 (-) True G717291
TU815069 lncRNA upstream 50589 49165364 ~ 49165811 (-) True G717297
TU815070 lncRNA upstream 51164 49165939 ~ 49166228 (-) True G717298
XM_021612710.2 mRNA downstream 443159 48356004 ~ 48616588 (-) False dlg1l
XM_021612715.2 mRNA downstream 443204 48356004 ~ 48616543 (-) False dlg1l
XM_021612739.2 mRNA upstream 7274 49122049 ~ 49140272 (-) False LOC110529994
XM_021612740.2 mRNA upstream 7274 49122049 ~ 49140273 (-) False LOC110529994
XM_021612741.2 mRNA upstream 7274 49122049 ~ 49140712 (-) True LOC110529994
XR_005053034.1 mRNA upstream 282024 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 327933 49442708 ~ 49490744 (-) False LOC110529999
TU814229 other downstream 270785 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 277232 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 298584 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 443224 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 770166 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 670899 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 751855 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1822153 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 2137580 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3646264 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU814997 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU814997 Expression in each Bioproject

Bar chart with 20 bars.
TU814997 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.