RNA id: TU815079



Basic Information


Item Value
RNA id TU815079
length 517
lncRNA type intronic
GC content 0.39
exon number 1
gene id G717307
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49178519 ~ 49179035 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aactgtatttttttgtgaagaatcaacaacaaatgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtcaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaagtagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggtcgtccctctaaactttcagctcatacaaggag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815070 lncRNA downstream 12291 49165939 ~ 49166228 (-) True G717298
TU815069 lncRNA downstream 12708 49165364 ~ 49165811 (-) True G717297
TU815063 lncRNA downstream 20801 49157228 ~ 49157718 (-) True G717291
TU815061 lncRNA downstream 22294 49155971 ~ 49156225 (-) True G717289
TU815054 lncRNA downstream 30730 49147567 ~ 49147789 (-) True G717282
TU815132 lncRNA upstream 64632 49243667 ~ 49244003 (-) True G717359
TU815147 lncRNA upstream 87115 49266150 ~ 49266351 (-) True G717374
TU815158 lncRNA upstream 99998 49279033 ~ 49280289 (-) True G717385
TU815163 lncRNA upstream 109754 49288789 ~ 49288992 (-) True G717390
TU815188 lncRNA upstream 140269 49319304 ~ 49319523 (-) True G717415
XM_021612741.2 mRNA downstream 37807 49122049 ~ 49140712 (-) True LOC110529994
XM_021612740.2 mRNA downstream 38246 49122049 ~ 49140273 (-) False LOC110529994
XM_021612739.2 mRNA downstream 38247 49122049 ~ 49140272 (-) False LOC110529994
XM_021612710.2 mRNA downstream 561931 48356004 ~ 48616588 (-) False dlg1l
XR_005053034.1 mRNA upstream 217764 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 263673 49442708 ~ 49490744 (-) False LOC110529999
XM_036985544.1 mRNA upstream 263673 49442708 ~ 49490750 (-) False LOC110529999
XM_036985547.1 mRNA upstream 263673 49442708 ~ 49490750 (-) False LOC110529999
XM_036985546.1 mRNA upstream 263673 49442708 ~ 49490756 (-) False LOC110529999
TU814229 other downstream 389557 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 396004 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 417356 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 561996 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 888938 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 606639 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 687595 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1757893 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 2073320 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3582004 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815079 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU815079 Expression in each Bioproject

Bar chart with 13 bars.
TU815079 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.