RNA id: TU815147



Basic Information


Item Value
RNA id TU815147
length 202
lncRNA type inter_gene
GC content 0.50
exon number 1
gene id G717374
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49266150 ~ 49266351 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ggacaaaaggaacacctatgtgagaatgctgttcattgactacagctcagcattcaacactatagtgcccatgaagctcatcactaagctaaggaccctgggacaaaacacctccttttgcatctggatcctggacttcctgacgggagccaccaggtggtaagggtaggcaacagcacgtctgccactctgatcctcaaca

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815132 lncRNA downstream 22147 49243667 ~ 49244003 (-) True G717359
TU815079 lncRNA downstream 87115 49178519 ~ 49179035 (-) True G717307
TU815070 lncRNA downstream 99922 49165939 ~ 49166228 (-) True G717298
TU815069 lncRNA downstream 100339 49165364 ~ 49165811 (-) True G717297
TU815063 lncRNA downstream 108432 49157228 ~ 49157718 (-) True G717291
TU815158 lncRNA upstream 12682 49279033 ~ 49280289 (-) True G717385
TU815163 lncRNA upstream 22438 49288789 ~ 49288992 (-) True G717390
TU815188 lncRNA upstream 52953 49319304 ~ 49319523 (-) True G717415
TU815191 lncRNA upstream 63361 49329712 ~ 49329973 (-) True G717418
TU815197 lncRNA upstream 78875 49345226 ~ 49345512 (-) True G717424
XM_021612741.2 mRNA downstream 125438 49122049 ~ 49140712 (-) True LOC110529994
XM_021612740.2 mRNA downstream 125877 49122049 ~ 49140273 (-) False LOC110529994
XM_021612739.2 mRNA downstream 125878 49122049 ~ 49140272 (-) False LOC110529994
XM_021612710.2 mRNA downstream 649562 48356004 ~ 48616588 (-) False dlg1l
XR_005053034.1 mRNA upstream 130448 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 176357 49442708 ~ 49490744 (-) False LOC110529999
XM_036985544.1 mRNA upstream 176357 49442708 ~ 49490750 (-) False LOC110529999
XM_036985547.1 mRNA upstream 176357 49442708 ~ 49490750 (-) False LOC110529999
XM_036985546.1 mRNA upstream 176357 49442708 ~ 49490756 (-) False LOC110529999
TU814229 other downstream 477188 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 483635 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 504987 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 649627 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 976569 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 519323 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 600279 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1670577 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1986004 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3494688 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815147 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU815147 Expression in each Bioproject

Bar chart with 12 bars.
TU815147 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.