RNA id: TU815188



Basic Information


Item Value
RNA id TU815188
length 220
lncRNA type intronic
GC content 0.56
exon number 1
gene id G717415
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49319304 ~ 49319523 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctcggtggacctgagccctaggaccatgcctcaggactacctggcatgatgactccttgctgtcccagtccacctggccgtgctgctgctccagtttcaactgttctgcctgcggctatggaaccctgacctgttcaccggatgtgctacctgtcccagacctgctgttttcaactctctagagacagcaggagcggtagagatactctcaatgatcgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815163 lncRNA downstream 30312 49288789 ~ 49288992 (-) True G717390
TU815158 lncRNA downstream 39015 49279033 ~ 49280289 (-) True G717385
TU815147 lncRNA downstream 52953 49266150 ~ 49266351 (-) True G717374
TU815132 lncRNA downstream 75301 49243667 ~ 49244003 (-) True G717359
TU815079 lncRNA downstream 140269 49178519 ~ 49179035 (-) True G717307
TU815191 lncRNA upstream 10189 49329712 ~ 49329973 (-) True G717418
TU815197 lncRNA upstream 25703 49345226 ~ 49345512 (-) True G717424
TU815198 lncRNA upstream 26024 49345547 ~ 49345889 (-) True G717425
TU815213 lncRNA upstream 40093 49359616 ~ 49359978 (-) True G717440
TU815219 lncRNA upstream 50165 49369688 ~ 49369932 (-) True G717446
XM_021612741.2 mRNA downstream 178592 49122049 ~ 49140712 (-) True LOC110529994
XM_021612740.2 mRNA downstream 179031 49122049 ~ 49140273 (-) False LOC110529994
XM_021612739.2 mRNA downstream 179032 49122049 ~ 49140272 (-) False LOC110529994
XM_021612710.2 mRNA downstream 702716 48356004 ~ 48616588 (-) False dlg1l
XR_005053034.1 mRNA upstream 77276 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 123185 49442708 ~ 49490744 (-) False LOC110529999
XM_036985544.1 mRNA upstream 123185 49442708 ~ 49490750 (-) False LOC110529999
XM_036985547.1 mRNA upstream 123185 49442708 ~ 49490750 (-) False LOC110529999
XM_036985546.1 mRNA upstream 123185 49442708 ~ 49490756 (-) False LOC110529999
TU814229 other downstream 530342 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 536789 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 558141 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 702781 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1029723 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 466151 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 547107 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1617405 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1932832 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3441516 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815188 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU815188 Expression in each Bioproject

Bar chart with 19 bars.
TU815188 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.