RNA id: TU815219



Basic Information


Item Value
RNA id TU815219
length 245
lncRNA type intronic
GC content 0.36
exon number 1
gene id G717446
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49369688 ~ 49369932 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTGGTCAGATAACACTTACAGTGAAGGATATTTCAAATAGGGAAGGAGGAATGTGTGTTTATGAGAAAAAGTATTTGTTGGAAAGATCACTGATGCTAAGGTCTACATATTTGGTTTATCTGCTACAACGGTAAGCAATCTCAGTCACACAATCCATCATAAAATATTCTACAAATCTCTGTTGATATAGTAGTATATGTCATAGCCTTGTGGCCGGTTCAAAATCAAAGTACTGACAGGATGAA

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU815213 lncRNA downstream 9710 49359616 ~ 49359978 (-) True G717440
TU815198 lncRNA downstream 23799 49345547 ~ 49345889 (-) True G717425
TU815197 lncRNA downstream 24176 49345226 ~ 49345512 (-) True G717424
TU815191 lncRNA downstream 39715 49329712 ~ 49329973 (-) True G717418
TU815188 lncRNA downstream 50165 49319304 ~ 49319523 (-) True G717415
TU815223 lncRNA upstream 3631 49373563 ~ 49374056 (-) True G717450
TU815225 lncRNA upstream 6578 49376510 ~ 49376712 (-) True G717452
TU815204 lncRNA upstream 113660 49483592 ~ 49485051 (-) True LOC110529999
TU815307 lncRNA upstream 143143 49513075 ~ 49514522 (-) True G717527
TU815308 lncRNA upstream 146768 49516700 ~ 49516983 (-) True G717528
XM_021612741.2 mRNA downstream 228976 49122049 ~ 49140712 (-) True LOC110529994
XM_021612740.2 mRNA downstream 229415 49122049 ~ 49140273 (-) False LOC110529994
XM_021612739.2 mRNA downstream 229416 49122049 ~ 49140272 (-) False LOC110529994
XM_021612710.2 mRNA downstream 753100 48356004 ~ 48616588 (-) False dlg1l
XR_005053034.1 mRNA upstream 26867 49396799 ~ 49396853 (-) True LOC118965653
XM_036985545.1 mRNA upstream 72776 49442708 ~ 49490744 (-) False LOC110529999
XM_036985544.1 mRNA upstream 72776 49442708 ~ 49490750 (-) False LOC110529999
XM_036985547.1 mRNA upstream 72776 49442708 ~ 49490750 (-) False LOC110529999
XM_036985546.1 mRNA upstream 72776 49442708 ~ 49490756 (-) False LOC110529999
TU814229 other downstream 580726 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 587173 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 608525 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 753165 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1080107 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 415742 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 496698 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1566996 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1882423 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3391107 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815219 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

TU815219 Expression in each Bioproject

Bar chart with 6 bars.
TU815219 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.