RNA id: TU815311



Basic Information


Item Value
RNA id TU815311
length 345
lncRNA type intronic
GC content 0.50
exon number 1
gene id G717531
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49520154 ~ 49520498 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttgccgcctgctatagaccaccctctgcccccagctgtgctctggacaccatatgtgaactgattgccccccatctatcttcagagctcgtgctgctaggcgacctaaactggaacatgcttaacaccccagccatcctacaatctaaacttgatgccctcaatctcacacaaattatcaatgaacctaccaggtacctccccaaagcattaaacacgggcaccctcatagctatcatcctaaccaacttcccctctaaatacacctctgctgtcttcaaccaagatctcagcgatcactgcctcattgcctgcatccgtaatgggtcagcggtcaaacgacct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815308 lncRNA downstream 3171 49516700 ~ 49516983 (-) True G717528
TU815307 lncRNA downstream 5632 49513075 ~ 49514522 (-) True G717527
TU815204 lncRNA downstream 35103 49483592 ~ 49485051 (-) True LOC110529999
TU815225 lncRNA downstream 143442 49376510 ~ 49376712 (-) True G717452
TU815223 lncRNA downstream 146098 49373563 ~ 49374056 (-) True G717450
TU815312 lncRNA upstream 1108 49521606 ~ 49521933 (-) True G717532
TU815314 lncRNA upstream 11489 49531987 ~ 49532535 (-) True G717534
TU815319 lncRNA upstream 22713 49543211 ~ 49544233 (-) True G717539
TU815320 lncRNA upstream 24300 49544798 ~ 49545015 (-) True G717540
TU815322 lncRNA upstream 26134 49546632 ~ 49546884 (-) True G717542
XM_036985541.1 mRNA downstream 28906 49442708 ~ 49491248 (-) False LOC110529999
XM_036985542.1 mRNA downstream 28906 49442708 ~ 49491248 (-) False LOC110529999
XM_036985543.1 mRNA downstream 28906 49442708 ~ 49491248 (-) False LOC110529999
XM_036985546.1 mRNA downstream 29398 49442708 ~ 49490756 (-) False LOC110529999
XM_036985547.1 mRNA downstream 29404 49442708 ~ 49490750 (-) False LOC110529999
XM_021612751.2 mRNA upstream 4240 49524738 ~ 49529686 (-) True LOC110530002
XR_005053024.1 mRNA upstream 56605 49577103 ~ 49578807 (-) False LOC118965614
XM_021612754.2 mRNA upstream 81041 49601539 ~ 49612229 (-) True LOC110530004
XR_002474470.2 mRNA upstream 109079 49629577 ~ 49630769 (-) False LOC110530005
XM_021612756.2 mRNA upstream 114977 49635475 ~ 49647848 (-) False LOC110530006
TU814229 other downstream 731192 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 737639 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 758991 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 903631 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1230573 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 265176 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 346132 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1416430 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1731857 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3240541 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815311 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU815311 Expression in each Bioproject

Bar chart with 16 bars.
TU815311 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.