RNA id: TU815322



Basic Information


Item Value
RNA id TU815322
length 253
lncRNA type intronic
GC content 0.50
exon number 1
gene id G717542
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49546632 ~ 49546884 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


actgtggtcccagctctcttcaggtcattgaccaggtcctgctgtgtagttctgggctgatccctcactttcctcatgatcattgatgccccacgaggtgagatcttgcatggagccccagaccgagggtgattgactgtcatcttgaacttcttccattttctaataattgcaccaacagttgttgccttctcaccaagctgcttgcctattgtcctgtagcccatcccagccttgtgcaggtctgcaattt

Function


GO: NA

KEGG:

id description

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815320 lncRNA downstream 1617 49544798 ~ 49545015 (-) True G717540
TU815319 lncRNA downstream 2399 49543211 ~ 49544233 (-) True G717539
TU815314 lncRNA downstream 14097 49531987 ~ 49532535 (-) True G717534
TU815312 lncRNA downstream 24699 49521606 ~ 49521933 (-) True G717532
TU815311 lncRNA downstream 26134 49520154 ~ 49520498 (-) True G717531
TU815323 lncRNA upstream 789 49547673 ~ 49547973 (-) True G717543
TU815324 lncRNA upstream 1332 49548216 ~ 49549071 (-) True G717544
TU815326 lncRNA upstream 3938 49550822 ~ 49551046 (-) True G717546
TU815327 lncRNA upstream 5003 49551887 ~ 49552086 (-) True G717547
TU815329 lncRNA upstream 6101 49552985 ~ 49553329 (-) True G717549
XM_021612751.2 mRNA downstream 16946 49524738 ~ 49529686 (-) True LOC110530002
XM_036985541.1 mRNA downstream 55384 49442708 ~ 49491248 (-) False LOC110529999
XM_036985542.1 mRNA downstream 55384 49442708 ~ 49491248 (-) False LOC110529999
XM_036985543.1 mRNA downstream 55384 49442708 ~ 49491248 (-) False LOC110529999
XM_036985546.1 mRNA downstream 55876 49442708 ~ 49490756 (-) False LOC110529999
XR_005053024.1 mRNA upstream 30219 49577103 ~ 49578807 (-) False LOC118965614
XM_021612754.2 mRNA upstream 54655 49601539 ~ 49612229 (-) True LOC110530004
XR_002474470.2 mRNA upstream 82693 49629577 ~ 49630769 (-) False LOC110530005
XM_021612756.2 mRNA upstream 88591 49635475 ~ 49647848 (-) False LOC110530006
XM_036985551.1 mRNA upstream 88591 49635475 ~ 49647848 (-) True LOC110530006
TU814229 other downstream 757670 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 764117 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 785469 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 930109 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1257051 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 238790 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 319746 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1390044 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1705471 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3214155 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815322 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU815322 Expression in each Bioproject

Bar chart with 18 bars.
TU815322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.