RNA id: TU815326



Basic Information


Item Value
RNA id TU815326
length 225
lncRNA type intronic
GC content 0.36
exon number 1
gene id G717546
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49550822 ~ 49551046 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cccccttaaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcacgaagtggaacgacatttattggatatttcaaacttttttaacatttcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagtt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815324 lncRNA downstream 1751 49548216 ~ 49549071 (-) True G717544
TU815323 lncRNA downstream 2849 49547673 ~ 49547973 (-) True G717543
TU815322 lncRNA downstream 3938 49546632 ~ 49546884 (-) True G717542
TU815320 lncRNA downstream 5807 49544798 ~ 49545015 (-) True G717540
TU815319 lncRNA downstream 6589 49543211 ~ 49544233 (-) True G717539
TU815327 lncRNA upstream 841 49551887 ~ 49552086 (-) True G717547
TU815329 lncRNA upstream 1939 49552985 ~ 49553329 (-) True G717549
TU815331 lncRNA upstream 3107 49554153 ~ 49554369 (-) True G717551
TU815333 lncRNA upstream 5228 49556274 ~ 49556634 (-) True G717553
TU815334 lncRNA upstream 5715 49556761 ~ 49556979 (-) True G717554
XM_021612751.2 mRNA downstream 21136 49524738 ~ 49529686 (-) True LOC110530002
XM_036985541.1 mRNA downstream 59574 49442708 ~ 49491248 (-) False LOC110529999
XM_036985542.1 mRNA downstream 59574 49442708 ~ 49491248 (-) False LOC110529999
XM_036985543.1 mRNA downstream 59574 49442708 ~ 49491248 (-) False LOC110529999
XM_036985546.1 mRNA downstream 60066 49442708 ~ 49490756 (-) False LOC110529999
XR_005053024.1 mRNA upstream 26057 49577103 ~ 49578807 (-) False LOC118965614
XM_021612754.2 mRNA upstream 50493 49601539 ~ 49612229 (-) True LOC110530004
XR_002474470.2 mRNA upstream 78531 49629577 ~ 49630769 (-) False LOC110530005
XM_021612756.2 mRNA upstream 84429 49635475 ~ 49647848 (-) False LOC110530006
XM_036985551.1 mRNA upstream 84429 49635475 ~ 49647848 (-) True LOC110530006
TU814229 other downstream 761860 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 768307 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 789659 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 934299 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1261241 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 234628 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 315584 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1385882 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1701309 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3209993 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815326 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU815326 Expression in each Bioproject

Bar chart with 16 bars.
TU815326 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.