RNA id: TU815334



Basic Information


Item Value
RNA id TU815334
length 219
lncRNA type antisense_over
GC content 0.52
exon number 1
gene id G717554
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49556761 ~ 49556979 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTAATGAACTCATTGCCAAATATGATTTCCTCTGCCACGCGGCCTCCCATGCTGACATCCATCTGGGCCAGCAGCTGAGCACGCGTCTCGCTCCAGCGGTCATCCTCCGGGAGCATAGACACCTAGGATGGACAGTGGGGGAAGAGGAGTGAGGCCTGGCAGCGAACGGAACCAACCACTTCAATTTGACGATTCTAAAAACATAAAAAACAATGATTT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815333 lncRNA downstream 127 49556274 ~ 49556634 (-) True G717553
TU815331 lncRNA downstream 2392 49554153 ~ 49554369 (-) True G717551
TU815329 lncRNA downstream 3432 49552985 ~ 49553329 (-) True G717549
TU815327 lncRNA downstream 4675 49551887 ~ 49552086 (-) True G717547
TU815326 lncRNA downstream 5715 49550822 ~ 49551046 (-) True G717546
TU815336 lncRNA upstream 1886 49558865 ~ 49559082 (-) True G717556
TU815340 lncRNA upstream 10390 49567369 ~ 49567576 (-) True G717560
TU815345 lncRNA upstream 16869 49573848 ~ 49574098 (-) True G717565
TU815351 lncRNA upstream 20782 49577761 ~ 49578615 (-) True LOC118965614
TU815305 lncRNA upstream 34251 49591230 ~ 49593744 (-) True G717525
XM_021612751.2 mRNA downstream 27075 49524738 ~ 49529686 (-) True LOC110530002
XM_036985541.1 mRNA downstream 65513 49442708 ~ 49491248 (-) False LOC110529999
XM_036985542.1 mRNA downstream 65513 49442708 ~ 49491248 (-) False LOC110529999
XM_036985543.1 mRNA downstream 65513 49442708 ~ 49491248 (-) False LOC110529999
XM_036985546.1 mRNA downstream 66005 49442708 ~ 49490756 (-) False LOC110529999
XR_005053024.1 mRNA upstream 20124 49577103 ~ 49578807 (-) False LOC118965614
XM_021612754.2 mRNA upstream 44560 49601539 ~ 49612229 (-) True LOC110530004
XR_002474470.2 mRNA upstream 72598 49629577 ~ 49630769 (-) False LOC110530005
XM_021612756.2 mRNA upstream 78496 49635475 ~ 49647848 (-) False LOC110530006
XM_036985551.1 mRNA upstream 78496 49635475 ~ 49647848 (-) True LOC110530006
TU814229 other downstream 767799 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 774246 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 795598 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 940238 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1267180 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 228695 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 309651 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1379949 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1695376 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3204060 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815334 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU815334 Expression in each Bioproject

Bar chart with 8 bars.
TU815334 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.