RNA id: TU815408



Basic Information


Item Value
RNA id TU815408
length 384
lncRNA type inter_gene
GC content 0.48
exon number 2
gene id G717617
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49667736 ~ 49672776 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtcatgtactgtcatgttgtgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgttgttaggttaccttttctccctctctttcccccagctgtgccttgtctcctcctaaccacctcgtcaccccgtttcccacctgttccctttttccctctgattaggtccctatatctctctctgtttttgttcctgtccttgtcggattcttgtttgttgtgtttcatgcctgaaccagactgtcgtcatgtttgctgtaaccttgtcttgtcctgtcggaatctgccggtccgtctgagcctacctatgtttggtaattaaagaagctctgtttaagttaattcgcttttgggtcctcattcacgcaccgtaaca

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815397 lncRNA downstream 37197 49629592 ~ 49630539 (-) True LOC110530005
TU815305 lncRNA downstream 73992 49591230 ~ 49593744 (-) True G717525
TU815351 lncRNA downstream 89121 49577761 ~ 49578615 (-) True LOC118965614
TU815345 lncRNA downstream 93638 49573848 ~ 49574098 (-) True G717565
TU815340 lncRNA downstream 100160 49567369 ~ 49567576 (-) True G717560
TU815413 lncRNA upstream 5441 49678217 ~ 49683069 (-) True G717622
TU816338 lncRNA upstream 69009 49741785 ~ 49742817 (-) True G718461
TU816415 lncRNA upstream 177465 49850241 ~ 49850528 (-) True G718537
TU816419 lncRNA upstream 182328 49855104 ~ 49855399 (-) True G718541
TU816425 lncRNA upstream 187188 49859964 ~ 49860783 (-) True G718544
XM_021612758.2 mRNA downstream 12578 49647933 ~ 49655158 (-) True zgc:110269
XM_021612759.2 mRNA downstream 13199 49647933 ~ 49654537 (-) False zgc:110269
XM_021612756.2 mRNA downstream 19888 49635475 ~ 49647848 (-) False LOC110530006
XM_036985551.1 mRNA downstream 19888 49635475 ~ 49647848 (-) True LOC110530006
XR_002474470.2 mRNA downstream 36967 49629577 ~ 49630769 (-) False LOC110530005
XM_021612765.2 mRNA upstream 193496 49866272 ~ 49909160 (-) False LOC110530011
XM_021612766.2 mRNA upstream 193496 49866272 ~ 49909160 (-) False LOC110530011
XM_021612767.2 mRNA upstream 193497 49866273 ~ 49921500 (-) False LOC110530011
XM_036985558.1 mRNA upstream 193498 49866274 ~ 49937001 (-) False LOC110530011
XR_005052889.1 mRNA upstream 208867 49881643 ~ 49886226 (-) False LOC118965522
TU814229 other downstream 878774 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 885221 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 906573 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 1051213 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1378155 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 112898 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 193854 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1264152 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1579579 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3088263 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU815408 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU815408 Expression in each Bioproject

Bar chart with 20 bars.
TU815408 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.