RNA id: TU816338



Basic Information


Item Value
RNA id TU816338
length 880
lncRNA type antisense_over
GC content 0.53
exon number 2
gene id G718461
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49741785 ~ 49742817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTTCCCAACATCATTGGCGGACTGCCAGCAGGTCTTCCATGCCGAGTTGGTGTGGCCGTTGATGACTGTTGCCCTGATACACCGTTCTTCTCTTGTGCTTTTGATTGCTCAAAGTTGTAGGTCCCCCTATCTCTGCTATCACGCCTGGGCAAGACATCTGAGCTGTAACCCACCCGGTCTTTGTCGCGCCTAGGATCTACCACATTGGCACTCTTGCCATAGCTATCGCGCCGGGGGGGCAGTTCTGAGCCATTGCAGCTTCTGTCCTTGCTGTCACGCCTGGCTTCAAGGCCATGTCTGGCGGACTCTTTGATGTCCTGTCGGGGTAAGAGCTCCATTCCATTGTAACTTCGTTCTTTGCCCTCTTGTCTAGACTCCAGGCCGTAGCTCGCCCTGTCTCGGTCTTTGCTATTACGTCTACACTCAAGGCCATTTCTGGGTGAATCTTTGCAATTTTGTCTGGGTAGGAGCTCCGGTGGCTGATCAATTCGTTCTTTGCTGTCATGTCTCGAATCCATTTCGTTCCTGGTTCGGTCTTTGCTATCTTGCCTGGGTAGAAGTTCCGGTGGGTTCTGGTGGCTGAGCCTTTCTTTGCTGTCTGGTCTGGACTCCACACCATTCCGGGGAGAGTCTTTACTGTCCTGCCTTAGTAAAGGCTCCATGCAGTGGACACTTCTGTCTTTGCTATTGCGCCTTGGCATCAATTCTATGTTATTGCAGCCCCTGTCCTTGGTGTCGCGTCTGTGAGAAGACGACTCTTTGCTACGTTCCTTACTCTCCCGTTTGGACTCCTTGCTCTCCCGTTTGGACTCCTTGCTGTGACTGTGCCGCTCCTTGCCGTCACGTTTGGACTCGCTGTTCGGCTTACACTTGGACTCGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU815382 lncRNA downstream 58110 49650591 ~ 49683675 (-) True G717596
TU815413 lncRNA downstream 58716 49678217 ~ 49683069 (-) True G717622
TU815408 lncRNA downstream 69009 49667736 ~ 49672776 (-) True G717617
TU815397 lncRNA downstream 111246 49629592 ~ 49630539 (-) True LOC110530005
TU815305 lncRNA downstream 148041 49591230 ~ 49593744 (-) True G717525
TU816415 lncRNA upstream 107424 49850241 ~ 49850528 (-) True G718537
TU816419 lncRNA upstream 112287 49855104 ~ 49855399 (-) True G718541
TU816425 lncRNA upstream 117147 49859964 ~ 49860783 (-) True G718544
TU816427 lncRNA upstream 121688 49864505 ~ 49864733 (-) True G718546
TU816426 lncRNA upstream 178126 49920943 ~ 49921141 (-) True LOC110530011
XM_021612758.2 mRNA downstream 86627 49647933 ~ 49655158 (-) True zgc:110269
XM_021612759.2 mRNA downstream 87248 49647933 ~ 49654537 (-) False zgc:110269
XM_021612756.2 mRNA downstream 93937 49635475 ~ 49647848 (-) False LOC110530006
XM_036985551.1 mRNA downstream 93937 49635475 ~ 49647848 (-) True LOC110530006
XR_002474470.2 mRNA downstream 111016 49629577 ~ 49630769 (-) False LOC110530005
XM_021612765.2 mRNA upstream 123455 49866272 ~ 49909160 (-) False LOC110530011
XM_021612766.2 mRNA upstream 123455 49866272 ~ 49909160 (-) False LOC110530011
XM_021612767.2 mRNA upstream 123456 49866273 ~ 49921500 (-) False LOC110530011
XM_036985558.1 mRNA upstream 123457 49866274 ~ 49937001 (-) False LOC110530011
XR_005052889.1 mRNA upstream 138826 49881643 ~ 49886226 (-) False LOC118965522
TU814229 other downstream 952823 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 959270 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 980622 48759912 ~ 48761163 (-) True G716463
TU813956 other downstream 1125262 48542291 ~ 48616523 (-) True dlg1l
TU813564 other downstream 1452204 48288942 ~ 48289581 (-) True G715865
TU816366 other upstream 42857 49785674 ~ 49837696 (-) True G718489
TU816422 other upstream 123813 49866630 ~ 49889252 (-) False LOC110530011
TU817090 other upstream 1194111 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1509538 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 3018222 52761039 ~ 52761451 (-) True G721275

Expression Profile


TU816338 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU816338 Expression in each Bioproject

Bar chart with 11 bars.
TU816338 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.