RNA id: TU816674



Basic Information


Item Value
RNA id TU816674
length 231
lncRNA type intronic
GC content 0.35
exon number 1
gene id G718781
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 50241664 ~ 50241894 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


caatatgtgctatgtaagaaagctaacgtttcagttccttgctcagaacatgagaacatatgaaagctggtggttccttttaacatgagtcttcaatattcccaggtaagaagttttaggttgtagttattataggactatttccctctataccatttgtatttcattaacctttgattattggatgttcttataggcactttagtattgccagtgtaacagtatagcttc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU816673 lncRNA downstream 415 50241001 ~ 50241249 (-) True G718780
TU816538 lncRNA downstream 169681 50068513 ~ 50071983 (-) False G718648
TU816539 lncRNA downstream 169681 50068513 ~ 50071983 (-) True G718648
TU816554 lncRNA downstream 182089 50051445 ~ 50059575 (-) True G718663
TU816514 lncRNA downstream 240471 49994926 ~ 50001193 (-) True G718625
TU816676 lncRNA upstream 7964 50249858 ~ 50250116 (-) True G718783
TU816677 lncRNA upstream 8857 50250751 ~ 50251056 (-) True G718784
TU816695 lncRNA upstream 55506 50297400 ~ 50383091 (-) False G718798
TU816731 lncRNA upstream 115419 50357313 ~ 50452833 (-) False G718834
TU816732 lncRNA upstream 115419 50357313 ~ 50452833 (-) True G718834
XM_021612771.2 mRNA downstream 145735 50093497 ~ 50095929 (-) True LOC110530015
LOC118965625 mRNA downstream 255459 49983389 ~ 49986205 (-) True LOC118965625
XM_021612768.2 mRNA downstream 271582 49964914 ~ 49970082 (-) True LOC110530012
XR_005052889.1 mRNA downstream 355438 49881643 ~ 49886226 (-) False LOC118965522
XM_021612772.2 mRNA upstream 95837 50337731 ~ 50366270 (-) True LOC110530016
XM_021612779.2 mRNA upstream 171086 50412980 ~ 50434787 (-) False LOC110530021
XM_036985563.1 mRNA upstream 171086 50412980 ~ 50434788 (-) True LOC110530021
XM_021612797.2 mRNA upstream 423737 50665631 ~ 50674317 (-) False LOC110530027
XM_036985586.1 mRNA upstream 423770 50665664 ~ 50674317 (-) True LOC110530027
TU816422 other downstream 352412 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 403968 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 1452702 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 1459149 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 1480501 48759912 ~ 48761163 (-) True G716463
TU817090 other upstream 695034 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1010461 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 2519145 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 3221288 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 3256254 53498148 ~ 53499730 (-) True G722459

Expression Profile


TU816674 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU816674 Expression in each Bioproject

Bar chart with 15 bars.
TU816674 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.