RNA id: TU817205



Basic Information


Item Value
RNA id TU817205
length 275
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G719255
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51095376 ~ 51095650 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatcgacctgtgtgtaatcaagtctctgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgggatactgttgtgaagaagtttaaagccggttttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817203 lncRNA downstream 10653 51084514 ~ 51084723 (-) True G719253
TU817202 lncRNA downstream 10866 51084243 ~ 51084510 (-) True G719252
TU817200 lncRNA downstream 13351 51081733 ~ 51082025 (-) True G719250
TU817152 lncRNA downstream 20367 50999394 ~ 51075009 (-) True G719208
TU817159 lncRNA downstream 27990 51055396 ~ 51067386 (-) True LOC110530040
TU817213 lncRNA upstream 9997 51105647 ~ 51105861 (-) True G719262
TU817214 lncRNA upstream 10789 51106439 ~ 51106679 (-) True G719263
TU817225 lncRNA upstream 23585 51119235 ~ 51119486 (-) True G719274
TU817227 lncRNA upstream 28694 51124344 ~ 51124577 (-) True G719276
TU817607 lncRNA upstream 32742 51128392 ~ 51128917 (-) False LOC110530042
XM_036985599.1 mRNA downstream 27575 51032565 ~ 51067801 (-) False LOC110530040
XR_005052895.1 mRNA downstream 27727 51066307 ~ 51067649 (-) False LOC110530040
XM_021612810.2 mRNA downstream 27756 51032565 ~ 51067620 (-) False LOC110530040
XM_021612808.2 mRNA downstream 27757 51032565 ~ 51067619 (-) False LOC110530040
XM_021612807.2 mRNA downstream 57297 51032565 ~ 51038079 (-) False LOC110530040
XM_021612813.2 mRNA upstream 31964 51127614 ~ 51189612 (-) False LOC110530042
XM_021612816.2 mRNA upstream 156705 51252355 ~ 51259056 (-) False LOC110530043
XM_021612817.2 mRNA upstream 156705 51252355 ~ 51259060 (-) False LOC110530043
XM_021612815.2 mRNA upstream 158515 51254165 ~ 51259061 (-) False LOC110530043
XM_036985600.1 mRNA upstream 220644 51316294 ~ 51323226 (-) False LOC110530045
TU817090 other downstream 155905 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1206124 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1257680 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2306414 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 2312861 48782121 ~ 48782515 (-) True G716480
TU817704 other upstream 156705 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 1665389 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2367532 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2402498 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2707793 53803443 ~ 53856065 (-) True G722602

Expression Profile


TU817205 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU817205 Expression in each Bioproject

Bar chart with 17 bars.
TU817205 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.