RNA id: TU817680



Basic Information


Item Value
RNA id TU817680
length 521
lncRNA type intronic
GC content 0.54
exon number 1
gene id G719696
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51223886 ~ 51224406 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


agggcgccagtggcaaattttccaatcttggtgttctctggcaaatgccaaacgtcctgtaagcacaacccccacctgtggacgtcgggccctcataccaccctcatggagtctgtttctgaccgtttgagcagacacatgcacatttgtgggctgctggaggtcattttgcagggctctggcagtgctcctcctgctcctccttgcacaaaggcggaggtagctgtcctgctgctgggttgttgccctcctacggcctcctccacgtctcctgatgtactggcctgtctcctggtagcgcctccatgctctggacactacgctaacagacacagcaaaccttcttgcaacagctcgcattgatgtgtcatcctggatgagctgcactacctcagccacttgtgtgggttgtagactctgtctcatgctaccactagagtgaaagcaccgccagcattcaatagtgaccaaaacatcagccaggaagcataggaactgagaagtggtctgtggttaccacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817608 lncRNA downstream 82683 51136329 ~ 51141203 (-) True LOC110530042
TU817607 lncRNA downstream 94969 51128392 ~ 51128917 (-) False LOC110530042
TU817227 lncRNA downstream 99309 51124344 ~ 51124577 (-) True G719276
TU817225 lncRNA downstream 104400 51119235 ~ 51119486 (-) True G719274
TU817214 lncRNA downstream 117207 51106439 ~ 51106679 (-) True G719263
TU817681 lncRNA upstream 123 51224529 ~ 51224765 (-) True G719697
TU817685 lncRNA upstream 3682 51228088 ~ 51228302 (-) True G719701
TU817686 lncRNA upstream 3995 51228401 ~ 51228671 (-) True G719702
TU817748 lncRNA upstream 87483 51311889 ~ 51312674 (-) False G719761
TU817752 lncRNA upstream 87483 51311889 ~ 51312602 (-) True G719761
XM_021612813.2 mRNA downstream 34274 51127614 ~ 51189612 (-) False LOC110530042
XM_036985599.1 mRNA downstream 156085 51032565 ~ 51067801 (-) False LOC110530040
XR_005052895.1 mRNA downstream 156237 51066307 ~ 51067649 (-) False LOC110530040
XM_021612810.2 mRNA downstream 156266 51032565 ~ 51067620 (-) False LOC110530040
XM_021612808.2 mRNA downstream 156267 51032565 ~ 51067619 (-) False LOC110530040
XM_021612816.2 mRNA upstream 27949 51252355 ~ 51259056 (-) False LOC110530043
XM_021612817.2 mRNA upstream 27949 51252355 ~ 51259060 (-) False LOC110530043
XM_021612815.2 mRNA upstream 29759 51254165 ~ 51259061 (-) False LOC110530043
XM_036985600.1 mRNA upstream 91888 51316294 ~ 51323226 (-) False LOC110530045
XM_021612821.2 mRNA upstream 91888 51316294 ~ 51323599 (-) False LOC110530045
TU817090 other downstream 284415 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1334634 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1386190 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2434924 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 2441371 48782121 ~ 48782515 (-) True G716480
TU817704 other upstream 27949 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 1536633 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2238776 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2273742 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2579037 53803443 ~ 53856065 (-) True G722602

Expression Profile


TU817680 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU817680 Expression in each Bioproject

Bar chart with 20 bars.
TU817680 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.