RNA id: TU817756



Basic Information


Item Value
RNA id TU817756
length 230
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G719762
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51313308 ~ 51313537 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGATAAACATTTTCAGCAAAATAAACAAATTTGAGAACACTTACAAAAATTCCAACTGAAGGTTTGTTCTGTACAGGTCACCGGTAATTGCAGAGGAGCCAGGGGCTGATTTGGGATTGGGCATATTTTCAGACCAAATCGTTCAGTAAGGAATGAGTTGCTCTCGACAGGCTGGCAAACCAGTCTTGTAGGAAAGACTTTTTAGGCCAATTCCAAATCCTCCTGTAAAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817748 lncRNA downstream 634 51311889 ~ 51312674 (-) False G719761
TU817752 lncRNA downstream 706 51311889 ~ 51312602 (-) True G719761
TU817686 lncRNA downstream 84637 51228401 ~ 51228671 (-) True G719702
TU817685 lncRNA downstream 85006 51228088 ~ 51228302 (-) True G719701
TU817681 lncRNA downstream 88543 51224529 ~ 51224765 (-) True G719697
TU817763 lncRNA upstream 14669 51328206 ~ 51328432 (-) True G719767
TU817790 lncRNA upstream 65682 51379219 ~ 51380062 (-) True LOC110530046
TU817833 lncRNA upstream 125417 51438954 ~ 51439395 (-) True G719835
TU817839 lncRNA upstream 131683 51445220 ~ 51445520 (-) True G719841
TU817840 lncRNA upstream 133202 51446739 ~ 51446984 (-) True G719842
XM_021612815.2 mRNA downstream 54247 51254165 ~ 51259061 (-) False LOC110530043
XM_021612817.2 mRNA downstream 54248 51252355 ~ 51259060 (-) False LOC110530043
XM_021612816.2 mRNA downstream 54252 51252355 ~ 51259056 (-) False LOC110530043
XM_021612813.2 mRNA downstream 123696 51127614 ~ 51189612 (-) False LOC110530042
XR_005052895.1 mRNA downstream 245659 51066307 ~ 51067649 (-) False LOC110530040
XM_036985600.1 mRNA upstream 2757 51316294 ~ 51323226 (-) False LOC110530045
XM_021612821.2 mRNA upstream 2757 51316294 ~ 51323599 (-) False LOC110530045
XM_021612822.2 mRNA upstream 2757 51316294 ~ 51323600 (-) False LOC110530045
XM_021612823.2 mRNA upstream 4455 51317992 ~ 51323600 (-) False LOC110530045
XM_036985601.1 mRNA upstream 4455 51317992 ~ 51323600 (-) True LOC110530045
TU817704 other downstream 54289 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 373837 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1424056 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1475612 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2524346 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 1447502 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2149645 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2184611 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2489906 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 2612691 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU817756 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU817756 Expression in each Bioproject

Bar chart with 7 bars.
TU817756 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.