RNA id: TU817833



Basic Information


Item Value
RNA id TU817833
length 442
lncRNA type antisense_over
GC content 0.54
exon number 1
gene id G719835
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51438954 ~ 51439395 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TCGAGCACTTCTTGAAGAAAACCCGCACGGATATCAAGGACATACAAGCCCCCAGGTCCTGAAAGGCCAGGTAGAAGCCGGCCTTGGAAATAGGGCCAAAGCTTCTCACTTTGGTGTTGATCCTGCCTGCCTCGAGCAAGGAAAAACTCTCATCAGGGGCAATGGTGTCAACTTTGACATAAGGGGTCTCCCTCCACAAGGGACTACTTTCCGTAGCGGTATCGCCATCAGACTCGTAGTAGAAGAGGTTAAAGGTCTCCTTGCAGGAGCCGGGGATGTTGGGAATACTGGCACAGTCACGGACGGAGAACTTGAGCTCCACGTAGACGCGCAGCACGCCCTTACGGGGGATGAAGTCCGTCCTCAGCCAATTGTTCTGGTTGGGTTCGCGCACATTGCACACCTGGTATGTCCTGATAGGACTCATTGAATCGTCGTAGCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817790 lncRNA downstream 58892 51379219 ~ 51380062 (-) True LOC110530046
TU817763 lncRNA downstream 110522 51328206 ~ 51328432 (-) True G719767
TU817756 lncRNA downstream 125417 51313308 ~ 51313537 (-) True G719762
TU817748 lncRNA downstream 126280 51311889 ~ 51312674 (-) False G719761
TU817752 lncRNA downstream 126352 51311889 ~ 51312602 (-) True G719761
TU817839 lncRNA upstream 5825 51445220 ~ 51445520 (-) True G719841
TU817840 lncRNA upstream 7344 51446739 ~ 51446984 (-) True G719842
TU817852 lncRNA upstream 26581 51465976 ~ 51466228 (-) True G719854
TU817888 lncRNA upstream 71892 51511287 ~ 51575248 (-) True G719886
TU817929 lncRNA upstream 144220 51583615 ~ 51584394 (-) True LOC110530053
XM_021612824.2 mRNA downstream 58091 51377904 ~ 51380863 (-) False LOC110530046
XM_021612822.2 mRNA downstream 115354 51316294 ~ 51323600 (-) False LOC110530045
XM_021612823.2 mRNA downstream 115354 51317992 ~ 51323600 (-) False LOC110530045
XM_036985601.1 mRNA downstream 115354 51317992 ~ 51323600 (-) True LOC110530045
XM_021612821.2 mRNA downstream 115355 51316294 ~ 51323599 (-) False LOC110530045
XM_021612828.2 mRNA upstream 56685 51496080 ~ 51516909 (-) True mfsd8l2
XM_021612831.2 mRNA upstream 85872 51525267 ~ 51546934 (-) True LOC110530051
XM_021612832.2 mRNA upstream 121405 51560800 ~ 51582355 (-) True LOC110530052
XM_021612833.2 mRNA upstream 144130 51583525 ~ 51591883 (-) False LOC110530053
XM_021612841.2 mRNA upstream 209143 51648538 ~ 51689345 (-) True si:dkey-18p12.4
TU817704 other downstream 179935 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 499483 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1549702 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1601258 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2649992 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 1321644 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2023787 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2058753 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2364048 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 2486833 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU817833 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

TU817833 Expression in each Bioproject

Bar chart with 5 bars.
TU817833 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.