RNA id: TU817839



Basic Information


Item Value
RNA id TU817839
length 301
lncRNA type antisense_over
GC content 0.64
exon number 1
gene id G719841
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51445220 ~ 51445520 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTGGTGATGTTGACGGTGGCGTATCGCGGTGCACCGGGGCTCTTCCCAGAGACGCCGTTGACCGCCTGGATCTCAAAGCTGTAGCGGGTGTGCGCCTGCAGGTTCCTCACCACCACCTTCCTCTGGGTCAGGCCGAGTCGGCGCGGCGACATGTCCATGTTGTCGTCGCAGCGCGAGCACGGGCTCTGGTCGCGCTGACACTTCTTACACACCACGTTGTAGATGACGTCGTCCCGCCCGCCGACGTCCAGCGGCTCCTCCCACTCCAGGGCGATCGAGGTCTCGTTCACCGTGGAGATGA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817833 lncRNA downstream 5825 51438954 ~ 51439395 (-) True G719835
TU817790 lncRNA downstream 65158 51379219 ~ 51380062 (-) True LOC110530046
TU817763 lncRNA downstream 116788 51328206 ~ 51328432 (-) True G719767
TU817756 lncRNA downstream 131683 51313308 ~ 51313537 (-) True G719762
TU817748 lncRNA downstream 132546 51311889 ~ 51312674 (-) False G719761
TU817840 lncRNA upstream 1219 51446739 ~ 51446984 (-) True G719842
TU817852 lncRNA upstream 20456 51465976 ~ 51466228 (-) True G719854
TU817888 lncRNA upstream 65767 51511287 ~ 51575248 (-) True G719886
TU817929 lncRNA upstream 138095 51583615 ~ 51584394 (-) True LOC110530053
TU817933 lncRNA upstream 142432 51587952 ~ 51588192 (-) True G719930
XM_021612824.2 mRNA downstream 64357 51377904 ~ 51380863 (-) False LOC110530046
XM_021612822.2 mRNA downstream 121620 51316294 ~ 51323600 (-) False LOC110530045
XM_021612823.2 mRNA downstream 121620 51317992 ~ 51323600 (-) False LOC110530045
XM_036985601.1 mRNA downstream 121620 51317992 ~ 51323600 (-) True LOC110530045
XM_021612821.2 mRNA downstream 121621 51316294 ~ 51323599 (-) False LOC110530045
XM_021612828.2 mRNA upstream 50560 51496080 ~ 51516909 (-) True mfsd8l2
XM_021612831.2 mRNA upstream 79747 51525267 ~ 51546934 (-) True LOC110530051
XM_021612832.2 mRNA upstream 115280 51560800 ~ 51582355 (-) True LOC110530052
XM_021612833.2 mRNA upstream 138005 51583525 ~ 51591883 (-) False LOC110530053
XM_021612841.2 mRNA upstream 203018 51648538 ~ 51689345 (-) True si:dkey-18p12.4
TU817704 other downstream 186201 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 505749 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1555968 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1607524 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2656258 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 1315519 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2017662 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2052628 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2357923 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 2480708 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU817839 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

TU817839 Expression in each Bioproject

Bar chart with 5 bars.
TU817839 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.