RNA id: TU819440



Basic Information


Item Value
RNA id TU819440
length 209
lncRNA type read_through
GC content 0.46
exon number 2
gene id G721236
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52484057 ~ 52591956 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tagtaatccactcattgggtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaacacattttaacaaattggtccttcgcacttctcagtatttgctattcagactttagtgtcagtagtgtagtggttatcacgttcgcctcacacgcgaaagtcagtcacacccttagtttt

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU819408 lncRNA downstream 24398 52448814 ~ 52459659 (-) True G721207
TU819406 lncRNA downstream 27199 52448383 ~ 52456858 (-) False G721207
TU819407 lncRNA downstream 27199 52448383 ~ 52456858 (-) False G721207
TU819401 lncRNA downstream 74829 52408868 ~ 52409228 (-) True G721203
TU819266 lncRNA downstream 191712 52291980 ~ 52292345 (-) True G721149
TU819473 lncRNA upstream 127330 52719286 ~ 52726784 (-) False G721260
TU819474 lncRNA upstream 128831 52720787 ~ 52726784 (-) False G721260
TU819472 lncRNA upstream 132992 52724948 ~ 52726784 (-) True G721260
TU819504 lncRNA upstream 186422 52778378 ~ 52778596 (-) True G721288
TU819505 lncRNA upstream 187080 52779036 ~ 52779473 (-) True G721289
trnav-cac-8 mRNA downstream 12 52483973 ~ 52484045 (-) True trnav-cac-8
XM_021612881.2 mRNA downstream 8300 52465692 ~ 52475757 (-) True LOC110530083
XM_036985641.1 mRNA downstream 47189 52379925 ~ 52436868 (-) False kif1ab
trnav-aac-85 mRNA upstream 1083 52593039 ~ 52593111 (-) True trnav-aac-85
trnav-aac-86 mRNA upstream 2256 52594212 ~ 52594284 (-) True trnav-aac-86
trnav-cac-31 mRNA upstream 3227 52595183 ~ 52595255 (-) True trnav-cac-31
trnav-aac-87 mRNA upstream 3429 52595385 ~ 52595457 (-) True trnav-aac-87
trnav-aac-88 mRNA upstream 5271 52597227 ~ 52597299 (-) True trnav-aac-88
TU817704 other downstream 1225038 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1544586 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2594805 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2646361 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 3695095 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 169083 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 871226 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 906192 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1211487 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1334272 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU819440 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU819440 Expression in each Bioproject

Bar chart with 7 bars.
TU819440 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.