RNA id: TU819441



Basic Information


Item Value
RNA id TU819441
length 240
lncRNA type read_through
GC content 0.44
exon number 2
gene id G721237
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52485609 ~ 52538339 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ttgctattcagactttagtttcagtagtgtattggttatcacgttcgcctcacacgcgaaagtcagtcacacccttagttttccaatcattcggtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaacacattttaacaaattggtccttcgcacttctcagtatttgctattcagactttagtttcagtagtgtattggtta

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819408 lncRNA downstream 25950 52448814 ~ 52459659 (-) True G721207
TU819406 lncRNA downstream 28751 52448383 ~ 52456858 (-) False G721207
TU819407 lncRNA downstream 28751 52448383 ~ 52456858 (-) False G721207
TU819401 lncRNA downstream 76381 52408868 ~ 52409228 (-) True G721203
TU819266 lncRNA downstream 193264 52291980 ~ 52292345 (-) True G721149
TU819457 lncRNA upstream 1741 52540080 ~ 52545734 (-) True G721248
TU819443 lncRNA upstream 50880 52589219 ~ 52656589 (-) True G721238
TU819473 lncRNA upstream 180947 52719286 ~ 52726784 (-) False G721260
TU819474 lncRNA upstream 182448 52720787 ~ 52726784 (-) False G721260
TU819472 lncRNA upstream 186609 52724948 ~ 52726784 (-) True G721260
trnav-cac-9 mRNA downstream 56 52485481 ~ 52485553 (-) True trnav-cac-9
trnav-aac-10 mRNA downstream 1362 52484175 ~ 52484247 (-) True trnav-aac-10
trnav-cac-8 mRNA downstream 1564 52483973 ~ 52484045 (-) True trnav-cac-8
XM_021612881.2 mRNA downstream 9852 52465692 ~ 52475757 (-) True LOC110530083
XM_036985642.1 mRNA downstream 48741 52379925 ~ 52436868 (-) False kif1ab
trnav-aac-51 mRNA upstream 34 52538373 ~ 52538445 (-) True trnav-aac-51
trnav-aac-52 mRNA upstream 1539 52539878 ~ 52539950 (-) True trnav-aac-52
trnav-aac-53 mRNA upstream 3694 52542033 ~ 52542105 (-) True trnav-aac-53
trnav-aac-54 mRNA upstream 5102 52543441 ~ 52543513 (-) True trnav-aac-54
trnav-aac-55 mRNA upstream 6609 52544948 ~ 52545020 (-) True trnav-aac-55
TU817704 other downstream 1226590 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1546138 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2596357 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2647913 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 3696647 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 222700 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 924843 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 959809 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1265104 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1387889 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU819441 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU819441 Expression in each Bioproject

Bar chart with 8 bars.
TU819441 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.