RNA id: TU819453



Basic Information


Item Value
RNA id TU819453
length 218
lncRNA type read_through
GC content 0.44
exon number 2
gene id G721245
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52533209 ~ 52668446 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


acttgattggagtccacctgtggtaaattcaaatgattggtcatttctgcagcattgaaggtacccaagaacagagtggcttccatcactcttaaatagaagaagtttggaaccaccaagcctcttccaagttccggcggcacacgataattcccggcttctcatgtctaccacacataatatcccaaatttagtaccacagaaagagccataatacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819437 lncRNA downstream 42806 52483522 ~ 52490403 (-) True G721235
TU819408 lncRNA downstream 73550 52448814 ~ 52459659 (-) True G721207
TU819406 lncRNA downstream 76351 52448383 ~ 52456858 (-) False G721207
TU819407 lncRNA downstream 76351 52448383 ~ 52456858 (-) False G721207
TU819401 lncRNA downstream 123981 52408868 ~ 52409228 (-) True G721203
TU819473 lncRNA upstream 50840 52719286 ~ 52726784 (-) False G721260
TU819474 lncRNA upstream 52341 52720787 ~ 52726784 (-) False G721260
TU819472 lncRNA upstream 56502 52724948 ~ 52726784 (-) True G721260
TU819504 lncRNA upstream 109932 52778378 ~ 52778596 (-) True G721288
TU819505 lncRNA upstream 110590 52779036 ~ 52779473 (-) True G721289
trnav-uac-6 mRNA downstream 394 52532743 ~ 52532815 (-) True trnav-uac-6
trnav-uac-5 mRNA downstream 596 52532541 ~ 52532613 (-) True trnav-uac-5
trnav-cac-25 mRNA downstream 781 52532356 ~ 52532428 (-) True trnav-cac-25
trnav-aac-47 mRNA downstream 1751 52531386 ~ 52531458 (-) True trnav-aac-47
trnav-aac-46 mRNA downstream 1953 52531184 ~ 52531256 (-) True trnav-aac-46
trnav-aac-134 mRNA upstream 799 52669245 ~ 52669317 (-) True trnav-aac-134
trnav-aac-135 mRNA upstream 2281 52670727 ~ 52670799 (-) True trnav-aac-135
trnav-cac-46 mRNA upstream 3587 52672033 ~ 52672105 (-) True trnav-cac-46
trnav-aac-136 mRNA upstream 3789 52672235 ~ 52672307 (-) True trnav-aac-136
trnav-cac-47 mRNA upstream 5095 52673541 ~ 52673613 (-) True trnav-cac-47
TU817704 other downstream 1274190 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1593738 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2643957 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2695513 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 3744247 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 92593 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 794736 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 829702 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1134997 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1257782 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU819453 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU819453 Expression in each Bioproject

Bar chart with 7 bars.
TU819453 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.